Regulon of FnrN/FixK/AadR in Rhizobium leguminosarum bv. viciae 3841

Properties
Regulator type:	Transcription factor
TF locus tag:	RL1880, pRL90019, pRL90025, RL2818
Regulator family:	CRP
Regulation mode:	repressor (activator)
Biological process:	Oxidative stress response; Nitrogen fixation
Effector:	Oxygen
Regulog:	FnrN/FixK/AadR - Rhizobiales
Statistics of regulated genes:
- Genes	33
- Operons	14
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 192 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By trascription factor - FnrN/FixK
By TF family - CRP
By effector - Oxygen
By pathway - Oxidative stress response
By pathway - Nitrogen fixation

Regulated operons
	Locus Tag	Name	Function
Position: -79 Score: 4.2 Sequence: GCTTTGCGATGAATCAATGC Locus tag: pRL90027 Name: adhA Funciton: Alcohol dehydrogenase (EC 1.1.1.1), zinc containing
	pRL90027	adhA	Alcohol dehydrogenase (EC 1.1.1.1), zinc containing
Position: -87 Score: 4.7 Sequence: GCCTTGTCCCAGGTCAATCC Position: -31 Score: 4.8 Sequence: GATTTGACGGTGATCAAAGA Locus tag: RL1883 Name: hspC2 Funciton: Small heat shock protein
	RL1883	hspC2	Small heat shock protein
Position: -218 Score: 5 Sequence: AGTTTGACCTGCCTCAAAGA Position: -69 Score: 5.3 Sequence: CTCTTGATCTGCATCAAGGA Locus tag: pRL100208 Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation Locus tag: pRL100209 Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH Locus tag: pRL100210 Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: pRL100210A Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion Locus tag: pRL100211 Name: null Funciton: transcriptional regulator, Crp/Fnr family
	pRL100208	ccoG	Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
	pRL100209	ccoH	Type cbb3 cytochrome oxidase biogenesis protein CcoH
	pRL100210	ccoI	Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
	pRL100210A	ccoS	Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
	pRL100211		transcriptional regulator, Crp/Fnr family
Position: -96 Score: 5.2 Sequence: TCGTTGACGCAGATCAAGGC Locus tag: pRL100205 Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1) Locus tag: pRL100206 Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1) Locus tag: pRL100206A Name: ccoQ Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1) Locus tag: pRL100207 Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
	pRL100205	ccoN	Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
	pRL100206	ccoO	Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
	pRL100206A	ccoQ	Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
	pRL100207	ccoP	Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
Position: -241 Score: 4.8 Sequence: AGTTTGACCGGTGTCAAGGA Position: -69 Score: 5.3 Sequence: TTCTTGATCTGCATCAAGGA Locus tag: pRL90015 Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation Locus tag: pRL90014 Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH Locus tag: pRL90013 Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: pRL90012A Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion Locus tag: pRL90012 Name: null Funciton: transcriptional regulator, Crp/Fnr family
	pRL90015	ccoG	Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
	pRL90014	ccoH	Type cbb3 cytochrome oxidase biogenesis protein CcoH
	pRL90013	ccoI	Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
	pRL90012A	ccoS	Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
	pRL90012		transcriptional regulator, Crp/Fnr family
Position: -96 Score: 5.2 Sequence: TTGTTGATGTAGATCAAGGA Locus tag: pRL90018 Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1) Locus tag: pRL90017 Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1) Locus tag: pRL90016A Name: ccoQ Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1) Locus tag: pRL90016 Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
	pRL90018	ccoN	Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
	pRL90017	ccoO	Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
	pRL90016A	ccoQ	Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
	pRL90016	ccoP	Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
Position: -70 Score: 5.3 Sequence: AACTTGATCAGGATCAATTA Locus tag: pRL90008 Name: hemA Funciton: 5-aminolevulinate synthase (EC 2.3.1.37)
	pRL90008	hemA	5-aminolevulinate synthase (EC 2.3.1.37)
Position: -65 Score: 5.2 Sequence: TGTTTGACCGGGATCAAGTC Locus tag: RL1876 Name: adhA Funciton: Alcohol dehydrogenase (EC 1.1.1.1), zinc containing
	RL1876	adhA	Alcohol dehydrogenase (EC 1.1.1.1), zinc containing
Position: -75 Score: 5.2 Sequence: TGCTTGATGAAGATCAACGA Locus tag: RL1878 Name: osmY Funciton: Osmotically inducible protein Y precursor
	RL1878	osmY	Osmotically inducible protein Y precursor
Position: -75 Score: 5.1 Sequence: GATTTGACCCAAGTCAAATT Locus tag: pRL90275 Name: cydR Funciton: Predicted transcriptional regulator, ArsR family Locus tag: pRL90276 Name: cydD Funciton: ATP-binding/permease protein CydD Locus tag: pRL90277 Name: cydC Funciton: ATP-binding/permease protein CydC Locus tag: pRL90278 Name: cydA Funciton: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-) Locus tag: pRL90279 Name: cydB Funciton: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
	pRL90275	cydR	Predicted transcriptional regulator, ArsR family
	pRL90276	cydD	ATP-binding/permease protein CydD
	pRL90277	cydC	ATP-binding/permease protein CydC
	pRL90278	cydA	Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)
	pRL90279	cydB	Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
Position: -135 Score: 5.7 Sequence: GCTTTGATCTAGATCAAACA Position: -103 Score: 4.2 Sequence: AAATTGATAATCCTCAAGCG Locus tag: RL2818 Name: fnrN Funciton: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
	RL2818	fnrN	Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
Position: -121 Score: 5.2 Sequence: TCCTTGATCTACATCAACAA Locus tag: pRL90019 Name: fixKf Funciton: Nitrogen fixation and oxygen response transcriptional regulator FixKf, Crp family Locus tag: pRL90020 Name: fixLf Funciton: Two-component oxygen-sensor histidine kinase FixLf
	pRL90019	fixKf	Nitrogen fixation and oxygen response transcriptional regulator FixKf, Crp family
	pRL90020	fixLf	Two-component oxygen-sensor histidine kinase FixLf
Position: -96 Score: 4.9 Sequence: CCGTTGACCAAAATCAATTC Locus tag: RL3726 Name: sinR Funciton: Biofilm formation transcriptional regulator SinR, Crp Family
	RL3726	sinR	Biofilm formation transcriptional regulator SinR, Crp Family
Position: -60 Score: 5 Sequence: TCATTGATGCGCGTCAATGC Locus tag: pRL90039 Name: COG2187 Funciton: Predicted kinase
	pRL90039	COG2187	Predicted kinase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of FnrN/FixK/AadR in Rhizobium leguminosarum bv. viciae 3841

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --