Regulon of FnrN/FixK/AadR in Nitrobacter winogradskyi Nb-255

Properties
Regulator type:	Transcription factor
TF locus tag:	Nwi_1036, Nwi_2061
Regulator family:	CRP
Regulation mode:	repressor (activator)
Biological process:	Oxidative stress response; Nitrogen fixation
Effector:	Oxygen
Regulog:	FnrN/FixK/AadR - Rhizobiales
Statistics of regulated genes:
- Genes	8
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 192 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By trascription factor - FnrN/FixK
By TF family - CRP
By effector - Oxygen
By pathway - Oxidative stress response
By pathway - Nitrogen fixation

Regulated operons
	Locus Tag	Name	Function
Position: -139 Score: 5.3 Sequence: CGATTGATCCAAATCAAGAT Position: -77 Score: 5.1 Sequence: GCCTTGACCTAAGTCAACGA Locus tag: Nwi_1034 Name: blr6062 Funciton: Putative cytochrome C6 precursor
	Nwi_1034	blr6062	Putative cytochrome C6 precursor
Position: -141 Score: 4.3 Sequence: CATTTGCGCCAGAGCAAATT Locus tag: Nwi_0242 Name: hemA Funciton: 5-aminolevulinate synthase (EC 2.3.1.37)
	Nwi_0242	hemA	5-aminolevulinate synthase (EC 2.3.1.37)
Position: -196 Score: 4.5 Sequence: TGTTTGATACAGCGCAAAGA Locus tag: Nwi_0761 Name: ctaC Funciton: Cytochrome c oxidase polypeptide II (EC 1.9.3.1) Locus tag: Nwi_0762 Name: ctaD Funciton: Cytochrome c oxidase polypeptide I (EC 1.9.3.1) Locus tag: Nwi_0763 Name: ctaB Funciton: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB Locus tag: Nwi_0764 Name: ctaX Funciton: Hypothetical protein in cta gene cluster Locus tag: Nwi_0765 Name: ctaG Funciton: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1 Locus tag: Nwi_0766 Name: ctaE Funciton: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
	Nwi_0761	ctaC	Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
	Nwi_0762	ctaD	Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
	Nwi_0763	ctaB	Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
	Nwi_0764	ctaX	Hypothetical protein in cta gene cluster
	Nwi_0765	ctaG	Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
	Nwi_0766	ctaE	Cytochrome c oxidase polypeptide III (EC 1.9.3.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD