Regulon of FnrN/FixK/AadR in Mesorhizobium loti MAFF303099

Properties
Regulator type:	Transcription factor
TF locus tag:	mll6578, mlr6409, mll6632
Regulator family:	CRP
Regulation mode:	repressor (activator)
Biological process:	Oxidative stress response; Nitrogen fixation
Effector:	Oxygen
Regulog:	FnrN/FixK/AadR - Rhizobiales
Statistics of regulated genes:
- Genes	18
- Operons	6
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 192 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By trascription factor - FnrN/FixK
By TF family - CRP
By effector - Oxygen
By pathway - Oxidative stress response
By pathway - Nitrogen fixation

Regulated operons
	Locus Tag	Name	Function
Position: -102 Score: 3.8 Sequence: GCCCTGATTTCGGTCAGCCT Locus tag: mlr6409 Name: fnrN Funciton: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
	mlr6409	fnrN	Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
Position: -98 Score: 5.2 Sequence: CGGTTGATGTCGATCAAGGA Locus tag: mlr7688 Name: ccmI Funciton: Cytochrome c heme lyase subunit CcmI Locus tag: mlr7689 Name: ccmE Funciton: Cytochrome c-type biogenesis protein CcmE, heme chaperone Locus tag: mlr7690 Name: ccmF Funciton: Cytochrome c heme lyase subunit CcmF Locus tag: mlr7691 Name: ccmH Funciton: Cytochrome c heme lyase subunit CcmH
	mlr7688	ccmI	Cytochrome c heme lyase subunit CcmI
	mlr7689	ccmE	Cytochrome c-type biogenesis protein CcmE, heme chaperone
	mlr7690	ccmF	Cytochrome c heme lyase subunit CcmF
	mlr7691	ccmH	Cytochrome c heme lyase subunit CcmH
Position: -103 Score: 5.1 Sequence: GCCTTGATTTCGGTCAAAGC Locus tag: mll6632 Name: fnrN Funciton: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
	mll6632	fnrN	Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
Position: -145 Score: 4.8 Sequence: CGATTGACCTGCAGCAAGGC Locus tag: mlr6415 Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation Locus tag: mlr6416 Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH Locus tag: mlr6417 Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: msr6418 Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
	mlr6415	ccoG	Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
	mlr6416	ccoH	Type cbb3 cytochrome oxidase biogenesis protein CcoH
	mlr6417	ccoI	Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
	msr6418	ccoS	Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
Position: -129 Score: 5.1 Sequence: GGATTGACCTGCATCAACGC Locus tag: mll6626 Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation Locus tag: mll6625 Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH Locus tag: mll6624 Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: msl6623 Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
	mll6626	ccoG	Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
	mll6625	ccoH	Type cbb3 cytochrome oxidase biogenesis protein CcoH
	mll6624	ccoI	Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
	msl6623	ccoS	Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
Position: -96 Score: 5.5 Sequence: GCTTTGACCTGGATCAAGGC Locus tag: mll6630 Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1) Locus tag: mll6629 Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1) Locus tag: msl6627 Name: ccoQ Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1) Locus tag: mll6628 Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
	mll6630	ccoN	Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
	mll6629	ccoO	Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
	msl6627	ccoQ	Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
	mll6628	ccoP	Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of FnrN/FixK/AadR in Mesorhizobium loti MAFF303099

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --