Regulon of FnrN/FixK/AadR in Brucella melitensis 16M

Properties
Regulator type:	Transcription factor
TF locus tag:	BMEI1294
Regulator family:	CRP
Regulation mode:	repressor (activator)
Biological process:	Oxidative stress response; Nitrogen fixation
Effector:	Oxygen
Regulog:	FnrN/FixK/AadR - Rhizobiales
Statistics of regulated genes:
- Genes	13
- Operons	6
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 192 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By trascription factor - FnrN/FixK
By TF family - CRP
By effector - Oxygen
By pathway - Oxidative stress response
By pathway - Nitrogen fixation

Regulated operons
	Locus Tag	Name	Function
Position: 19 Score: 4.2 Sequence: CATTAGATCAGAATCAAAAG Locus tag: BMEI1294 Name: fnrN Funciton: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
	BMEI1294	fnrN	Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
Position: -108 Score: 5.5 Sequence: TGTTTGATTTAGATCAATGA Locus tag: BMEI1564 Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1) Locus tag: BMEI1565 Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1) Locus tag: BMEI1566 Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1) Locus tag: BMEI1567 Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation Locus tag: BMEI1568 Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH Locus tag: BMEI1569 Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
	BMEI1564	ccoN	Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
	BMEI1565	ccoO	Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
	BMEI1566	ccoP	Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
	BMEI1567	ccoG	Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
	BMEI1568	ccoH	Type cbb3 cytochrome oxidase biogenesis protein CcoH
	BMEI1569	ccoI	Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
Position: -108 Score: 5.5 Sequence: TCTTTGATTTGGATCAATGG Locus tag: BMEI0454 Name: ompW Funciton: Outer membrane protein W precursor
	BMEI0454	ompW	Outer membrane protein W precursor
Position: -145 Score: 4.2 Sequence: GCATTGCGTCTAATCAAGGA Locus tag: BMEI1746 Name: adhA Funciton: Alcohol dehydrogenase (EC 1.1.1.1), zinc containing
	BMEI1746	adhA	Alcohol dehydrogenase (EC 1.1.1.1), zinc containing
Position: -85 Score: 4.6 Sequence: CTCTTGACGGAAATCAACGC Locus tag: BMEI0925 Name: adhA Funciton: Alcohol dehydrogenase (EC 1.1.1.1), zinc containing
	BMEI0925	adhA	Alcohol dehydrogenase (EC 1.1.1.1), zinc containing
Position: -188 Score: 3.7 Sequence: CCTTTGTCTTAACGCAAACA Position: -95 Score: 4.6 Sequence: ATATTGATTGCGGTCAAGGA Locus tag: BMEII0988 Name: nirK Funciton: Copper-containing nitrite reductase (EC 1.7.2.1) Locus tag: BMEII0987 Name: nirV Funciton: Nitrite reductase accessory protein NirV Locus tag: BMEII0986 Name: nnrR Funciton: Nitric oxide stress response transcriptional regulator NnrR, Crp family
	BMEII0988	nirK	Copper-containing nitrite reductase (EC 1.7.2.1)
	BMEII0987	nirV	Nitrite reductase accessory protein NirV
	BMEII0986	nnrR	Nitric oxide stress response transcriptional regulator NnrR, Crp family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD