Regulon of UxuR in Roseburia intestinalis L1-82

Properties
Regulator type:	Transcription factor
TF locus tag:	ROSINTL182_03040
Regulator family:	LacI
Regulation mode:
Biological process:	Glucuronate utilization
Effector:
Regulog:	UxuR - Clostridia-3
Statistics of regulated genes:
- Genes	5
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 40 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-3
By TF family - LacI
By pathway - Glucuronate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -45 Score: 6.1 Sequence: AAATGTAACCGCTTACATAA Locus tag: ROSINTL182_00594 Name: PF02743 Funciton: hypothetical protein
	ROSINTL182_00594	PF02743	hypothetical protein
Position: -126 Score: 6.3 Sequence: ATTTGTAAGCGCTTACAAAA Locus tag: ROSINTL182_00339 Name: ugl Funciton: Unsaturated glucuronyl hydrolase (EC 3.2.1.-
	ROSINTL182_00339	ugl	Unsaturated glucuronyl hydrolase (EC 3.2.1.-
Position: -139 Score: 5.3 Sequence: AAATGAAAGCAGTTTCATTA Locus tag: ROSINTL182_03039 Name: uxaB Funciton: Altronate oxidoreductase (EC 1.1.1.58)
	ROSINTL182_03039	uxaB	Altronate oxidoreductase (EC 1.1.1.58)
Position: -249 Score: 6.1 Sequence: TTTTGTAAGCGTTTACAATT Position: -63 Score: 5.3 Sequence: TAATGAAACTGCTTTCATTT Locus tag: ROSINTL182_03040 Name: uxuR Funciton: Predicted transcription regulator for glucuronate utilization, LacI family Locus tag: ROSINTL182_03041 Name: uxaC Funciton: Uronate isomerase (EC 5.3.1.12)
	ROSINTL182_03040	uxuR	Predicted transcription regulator for glucuronate utilization, LacI family
	ROSINTL182_03041	uxaC	Uronate isomerase (EC 5.3.1.12)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD