Regulon of UxuR in Bryantella formatexigens DSM 14469

Properties
Regulator type:	Transcription factor
TF locus tag:	BRYFOR_01977
Regulator family:	LacI
Regulation mode:
Biological process:	Glucuronate utilization
Effector:
Regulog:	UxuR - Clostridia-3
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 40 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-3
By TF family - LacI
By pathway - Glucuronate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -228 Score: 6.3 Sequence: AAATGTAAGCGCTTACACAA Position: -78 Score: 5.9 Sequence: GATTGTAAGCGCTTACATGG Locus tag: BRYFOR_01978 Name: uxuB Funciton: D-mannonate oxidoreductase (EC 1.1.1.57)
	BRYFOR_01978	uxuB	D-mannonate oxidoreductase (EC 1.1.1.57)
Position: -252 Score: 5.9 Sequence: CCATGTAAGCGCTTACAATC Position: -102 Score: 6.3 Sequence: TTGTGTAAGCGCTTACATTT Locus tag: BRYFOR_01977 Name: uxuR Funciton: Predicted transcription regulator for glucuronate utilization, LacI family Locus tag: BRYFOR_01976 Name: uxaC Funciton: Uronate isomerase (EC 5.3.1.12)
	BRYFOR_01977	uxuR	Predicted transcription regulator for glucuronate utilization, LacI family
	BRYFOR_01976	uxaC	Uronate isomerase (EC 5.3.1.12)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD