Regulon of MntR in Listeria welshimeri serovar 6b str. SLCC5334

Properties
Regulator type:	Transcription factor
TF locus tag:	lwe1897
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Regulog:	MntR - Listeriaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Listeriaceae
By trascription factor - MntR
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -68 Score: 6.4 Sequence: AAAGTTGCTCTAAGGAAACATT Locus tag: lwe1868 Name: mntB Funciton: Manganese ABC transporter, inner membrane permease protein Locus tag: lwe1867 Name: mntC Funciton: Manganese ABC transporter, inner membrane permease protein Locus tag: lwe1866 Name: mntA Funciton: Manganese ABC transporter, inner membrane permease protein
	lwe1868	mntB	Manganese ABC transporter, inner membrane permease protein
	lwe1867	mntC	Manganese ABC transporter, inner membrane permease protein
	lwe1866	mntA	Manganese ABC transporter, inner membrane permease protein
Position: -51 Score: 6.4 Sequence: AATGTTTCCCGTAGTAAACTTT Locus tag: lwe1441 Name: mntH Funciton: Manganese transport protein MntH
	lwe1441	mntH	Manganese transport protein MntH

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD