Regulon of MntR in Listeria monocytogenes EGD-e

Properties
Regulator type:	Transcription factor
TF locus tag:	lmo1878
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Regulog:	MntR - Listeriaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Listeriaceae
By trascription factor - MntR
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -68 Score: 6.4 Sequence: AAAGTTGCTCTAAGGAAACATT Locus tag: lmo1849 Name: mntB Funciton: Manganese ABC transporter, inner membrane permease protein Locus tag: lmo1848 Name: mntC Funciton: Manganese ABC transporter, inner membrane permease protein Locus tag: lmo1847 Name: mntA Funciton: Manganese ABC transporter, inner membrane permease protein
	lmo1849	mntB	Manganese ABC transporter, inner membrane permease protein
	lmo1848	mntC	Manganese ABC transporter, inner membrane permease protein
	lmo1847	mntA	Manganese ABC transporter, inner membrane permease protein
Position: -51 Score: 6.4 Sequence: AATGTTTCCCGTAGTAAACTTT Locus tag: lmo1424 Name: mntH Funciton: Manganese transport protein MntH
	lmo1424	mntH	Manganese transport protein MntH

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD