Regulon of MntR in Listeria innocua Clip11262

Properties
Regulator type:	Transcription factor
TF locus tag:	lin1991
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Regulog:	MntR - Listeriaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Listeriaceae
By trascription factor - MntR
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -68 Score: 6.3 Sequence: AAAGTTGCATTAAGGAAACATT Locus tag: lin1963 Name: mntB Funciton: Manganese ABC transporter, inner membrane permease protein Locus tag: lin1962 Name: mntC Funciton: Manganese ABC transporter, inner membrane permease protein Locus tag: lin1961 Name: mntA Funciton: Manganese ABC transporter, inner membrane permease protein
	lin1963	mntB	Manganese ABC transporter, inner membrane permease protein
	lin1962	mntC	Manganese ABC transporter, inner membrane permease protein
	lin1961	mntA	Manganese ABC transporter, inner membrane permease protein
Position: -51 Score: 6.4 Sequence: AATGTTTCCCGTAGTAAACTTT Locus tag: lin1463 Name: mntH Funciton: Manganese transport protein MntH
	lin1463	mntH	Manganese transport protein MntH

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD