Regulon of GudR in Methylibium petroleiphilum PM1

Properties
Regulator type:	Transcription factor
TF locus tag:	Mpe_A0968
Regulator family:	LacI
Regulation mode:
Biological process:	Glucarate utilization
Effector:
Regulog:	GudR - Comamonadaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 11 sites [see more]

Member of regulog collections

By taxonomy - Comamonadaceae
By TF family - LacI
By pathway - Glucarate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -73 Score: 6 Sequence: GAACGGTAGCGCTACCATTT Position: -51 Score: 4.8 Sequence: AGACGATAGCGCTACCAGAT Locus tag: Mpe_A0969 Name: tctC4 Funciton: Tripartite tricarboxylate transporter family receptor, putative transporter for uronates Locus tag: Mpe_A0970 Name: gudD Funciton: Glucarate dehydratase (EC 4.2.1.40)
	Mpe_A0969	tctC4	Tripartite tricarboxylate transporter family receptor, putative transporter for uronates
	Mpe_A0970	gudD	Glucarate dehydratase (EC 4.2.1.40)
Position: -36 Score: 5.5 Sequence: GGATGGTAGCGGTGTCATCT Locus tag: Mpe_A0968 Name: gudR Funciton: Predicted D-glucarate utilization regulator, LacI family
	Mpe_A0968	gudR	Predicted D-glucarate utilization regulator, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD