Regulog GudR - Comamonadaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Glucarate utilization |
| Effector: | |
| Phylum: | Proteobacteria/Beta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Comamonadaceae
- By TF family - LacI
- By pathway - Glucarate utilization
| Genome | Genes | Operons |
|---|---|---|
| Leptothrix cholodnii SP-6 | ||
| Methylibium petroleiphilum PM1 | 3 | 2 |
| Verminephrobacter eiseniae EF01-2 | ||
| Delftia acidovorans SPH-1 | ||
| Acidovorax avenae subsp. citrulli AAC00-1 | 3 | 2 |
| Acidovorax sp. JS42 | ||
| Comamonas testosteroni KF-1 | ||
| Variovorax paradoxus S110 | ||
| Rhodoferax ferrireducens DSM 15236 | ||
| Polaromonas sp. JS666 | 7 | 4 |
| Polaromonas naphthalenivorans CJ2 | 1 | 1 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| tctC |
|
|
Gene: Veis_3406: Tripartite tricarboxylate transporter family receptor, putative transporter for uronates |
|
|
|
|
Gene: Vapar_5709: Tripartite tricarboxylate transporter family receptor, putative transporter for uronates |
|
*
Polaromonas sp. JS666 Site: position = -79 score = 5.88688 sequence = AATTGTTAGCGCTAACATTC Gene: Bpro_4526: Tripartite tricarboxylate transporter family receptor, putative transporter for uronates |
|
Tripartite tricarboxylate transporter family receptor, putative transporter for uronates |
| CRON 2. | ||||||||||||
| gudR |
|
*
Methylibium petroleiphilum PM1 Site: position = -36 score = 5.47034 sequence = GGATGGTAGCGGTGTCATCT Gene: Mpe_A0968: Predicted D-glucarate utilization regulator, LacI family |
|
|
*
Acidovorax avenae subsp. citrulli AAC00-1 Site: position = -110 score = 5.87948 sequence = GGATGTTAACGTTAACATCC Gene: Aave_3625: Predicted D-glucarate utilization regulator, LacI family |
|
|
|
|
*2
Polaromonas sp. JS666 Site: position = -24 score = 4.89221 sequence = GCAAGTTAGCGTTAACATCA Gene: Bpro_4527: Predicted D-glucarate utilization regulator, LacI family Site: position = -33 score = 5.19335 sequence = GACTGGTAGCGCTATCGTCG Gene: Bpro_3418: Predicted D-glucarate utilization regulator, LacI family |
Gene: Pnap_1131: Predicted D-glucarate utilization regulator, LacI family |
Predicted D-glucarate utilization regulator, LacI family |
| CRON 3. | ||||||||||||
| kdgD |
|
|
|
|
|
|
|
|
|
*
Polaromonas sp. JS666 Site: position = -29 score = 5.98784 sequence = AAAAGGTAGCGCTACCATTC Site: position = -2 score = 5.50353 sequence = CAATGGTAGCGCTACCTTTA Gene: Bpro_3419: 5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41) |
|
5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41) |
| tctC4 |
|
*
Methylibium petroleiphilum PM1 Site: position = -73 score = 5.98784 sequence = GAACGGTAGCGCTACCATTT Site: position = -51 score = 4.80949 sequence = AGACGATAGCGCTACCAGAT Gene: Mpe_A0969: Tripartite tricarboxylate transporter family receptor, putative transporter for uronates |
|
|
*
Acidovorax avenae subsp. citrulli AAC00-1 Site: position = -40 score = 5.87948 sequence = GGATGTTAACGTTAACATCC Gene: Aave_3624: Tripartite tricarboxylate transporter family receptor, putative transporter for uronates |
|
|
|
|
Gene: Bpro_3420: Tripartite tricarboxylate transporter family receptor, putative transporter for uronates |
|
Tripartite tricarboxylate transporter family receptor, putative transporter for uronates |
| gudD |
|
Gene: Mpe_A0970: Glucarate dehydratase (EC 4.2.1.40) |
|
|
Gene: Aave_3623: Glucarate dehydratase (EC 4.2.1.40) |
|
|
|
|
Gene: Bpro_3421: Glucarate dehydratase (EC 4.2.1.40) |
*
Polaromonas naphthalenivorans CJ2 Site: position = -93 score = 5.6931 sequence = AAATGTTACCGATAACATTG Gene: Pnap_1130: Glucarate dehydratase (EC 4.2.1.40) |
Glucarate dehydratase (EC 4.2.1.40) |
| kgsD |
|
|
|
|
|
|
|
|
|
Gene: Bpro_3422: Alpha-ketoglutaric semialdehyde dehydrogenase (EC 1.2.1.26) |
|
Alpha-ketoglutaric semialdehyde dehydrogenase (EC 1.2.1.26) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |