Regulog GudR - Comamonadaceae

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:
Biological process:	Glucarate utilization
Effector:
Phylum:	Proteobacteria/Beta
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 11 sites [see more]

Member of regulog collections

By taxonomy - Comamonadaceae
By TF family - LacI
By pathway - Glucarate utilization

Statistics of regulated genes
Genome	Genes	Operons
Leptothrix cholodnii SP-6
Methylibium petroleiphilum PM1	3	2
Verminephrobacter eiseniae EF01-2
Delftia acidovorans SPH-1
Acidovorax avenae subsp. citrulli AAC00-1	3	2
Acidovorax sp. JS42
Comamonas testosteroni KF-1
Variovorax paradoxus S110
Rhodoferax ferrireducens DSM 15236
Polaromonas sp. JS666	7	4
Polaromonas naphthalenivorans CJ2	1	1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes												Function

CRON 1.
tctC	Leptothrix cholodnii SP-6	Methylibium petroleiphilum PM1	Verminephrobacter eiseniae EF01-2 Gene: Veis_3406: Tripartite tricarboxylate transporter family receptor, putative transporter for uronates	Delftia acidovorans SPH-1	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Variovorax paradoxus S110 Gene: Vapar_5709: Tripartite tricarboxylate transporter family receptor, putative transporter for uronates	Rhodoferax ferrireducens DSM 15236	* Polaromonas sp. JS666 Site: position = -79 score = 5.88688 sequence = AATTGTTAGCGCTAACATTC Gene: Bpro_4526: Tripartite tricarboxylate transporter family receptor, putative transporter for uronates	Polaromonas naphthalenivorans CJ2	Tripartite tricarboxylate transporter family receptor, putative transporter for uronates

CRON 2.
gudR	Leptothrix cholodnii SP-6	* Methylibium petroleiphilum PM1 Site: position = -36 score = 5.47034 sequence = GGATGGTAGCGGTGTCATCT Gene: Mpe_A0968: Predicted D-glucarate utilization regulator, LacI family	Verminephrobacter eiseniae EF01-2	Delftia acidovorans SPH-1	* Acidovorax avenae subsp. citrulli AAC00-1 Site: position = -110 score = 5.87948 sequence = GGATGTTAACGTTAACATCC Gene: Aave_3625: Predicted D-glucarate utilization regulator, LacI family	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Variovorax paradoxus S110	Rhodoferax ferrireducens DSM 15236	2 Polaromonas sp. JS666* Site: position = -24 score = 4.89221 sequence = GCAAGTTAGCGTTAACATCA Gene: Bpro_4527: Predicted D-glucarate utilization regulator, LacI family Site: position = -33 score = 5.19335 sequence = GACTGGTAGCGCTATCGTCG Gene: Bpro_3418: Predicted D-glucarate utilization regulator, LacI family	Polaromonas naphthalenivorans CJ2 Gene: Pnap_1131: Predicted D-glucarate utilization regulator, LacI family	Predicted D-glucarate utilization regulator, LacI family

CRON 3.
kdgD	Leptothrix cholodnii SP-6	Methylibium petroleiphilum PM1	Verminephrobacter eiseniae EF01-2	Delftia acidovorans SPH-1	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Variovorax paradoxus S110	Rhodoferax ferrireducens DSM 15236	* Polaromonas sp. JS666 Site: position = -29 score = 5.98784 sequence = AAAAGGTAGCGCTACCATTC Site: position = -2 score = 5.50353 sequence = CAATGGTAGCGCTACCTTTA Gene: Bpro_3419: 5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41)	Polaromonas naphthalenivorans CJ2	5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41)
tctC4	Leptothrix cholodnii SP-6	* Methylibium petroleiphilum PM1 Site: position = -73 score = 5.98784 sequence = GAACGGTAGCGCTACCATTT Site: position = -51 score = 4.80949 sequence = AGACGATAGCGCTACCAGAT Gene: Mpe_A0969: Tripartite tricarboxylate transporter family receptor, putative transporter for uronates	Verminephrobacter eiseniae EF01-2	Delftia acidovorans SPH-1	* Acidovorax avenae subsp. citrulli AAC00-1 Site: position = -40 score = 5.87948 sequence = GGATGTTAACGTTAACATCC Gene: Aave_3624: Tripartite tricarboxylate transporter family receptor, putative transporter for uronates	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Variovorax paradoxus S110	Rhodoferax ferrireducens DSM 15236	Polaromonas sp. JS666 Gene: Bpro_3420: Tripartite tricarboxylate transporter family receptor, putative transporter for uronates	Polaromonas naphthalenivorans CJ2	Tripartite tricarboxylate transporter family receptor, putative transporter for uronates
gudD	Leptothrix cholodnii SP-6	Methylibium petroleiphilum PM1 Gene: Mpe_A0970: Glucarate dehydratase (EC 4.2.1.40)	Verminephrobacter eiseniae EF01-2	Delftia acidovorans SPH-1	Acidovorax avenae subsp. citrulli AAC00-1 Gene: Aave_3623: Glucarate dehydratase (EC 4.2.1.40)	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Variovorax paradoxus S110	Rhodoferax ferrireducens DSM 15236	Polaromonas sp. JS666 Gene: Bpro_3421: Glucarate dehydratase (EC 4.2.1.40)	* Polaromonas naphthalenivorans CJ2 Site: position = -93 score = 5.6931 sequence = AAATGTTACCGATAACATTG Gene: Pnap_1130: Glucarate dehydratase (EC 4.2.1.40)	Glucarate dehydratase (EC 4.2.1.40)
kgsD	Leptothrix cholodnii SP-6	Methylibium petroleiphilum PM1	Verminephrobacter eiseniae EF01-2	Delftia acidovorans SPH-1	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Variovorax paradoxus S110	Rhodoferax ferrireducens DSM 15236	Polaromonas sp. JS666 Gene: Bpro_3422: Alpha-ketoglutaric semialdehyde dehydrogenase (EC 1.2.1.26)	Polaromonas naphthalenivorans CJ2	Alpha-ketoglutaric semialdehyde dehydrogenase (EC 1.2.1.26)

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog GudR - Comamonadaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --