Regulon of SdhR in Laribacter hongkongensis HLHK9

Properties
Regulator type:	Transcription factor
TF locus tag:	LHK_02422
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Tricarboxylic acid cycle
Effector:
Regulog:	SdhR - Various betaproteobacteria
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 24 sites [see more]

Member of regulog collections

By taxonomy - Various betaproteobacteria
By TF family - GntR/Others
By pathway - Tricarboxylic acid cycle

Regulated operons
	Locus Tag	Name	Function
Position: -62 Score: 6.2 Sequence: TTTTATATCTTATATAAGACATGCAT Locus tag: LHK_02422 Name: sdhR Funciton: Transcriptional regulator of TCA cycle, GntR family
	LHK_02422	sdhR	Transcriptional regulator of TCA cycle, GntR family
Position: -189 Score: 6.2 Sequence: ATGCATGTCTTATATAAGATATAAAA Locus tag: LHK_02423 Name: mdh Funciton: Malate dehydrogenase (EC 1.1.1.37)
	LHK_02423	mdh	Malate dehydrogenase (EC 1.1.1.37)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD