Regulon of SdhR in Methylotenera mobilis JLW8

Properties
Regulator type:	Transcription factor
TF locus tag:	Mmol_0754
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Tricarboxylic acid cycle
Effector:
Regulog:	SdhR - Various betaproteobacteria
Statistics of regulated genes:
- Genes	18
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 24 sites [see more]

Member of regulog collections

By taxonomy - Various betaproteobacteria
By TF family - GntR/Others
By pathway - Tricarboxylic acid cycle

Regulated operons
	Locus Tag	Name	Function
Position: -91 Score: 7.4 Sequence: TTTTATATCTTATATAAGACATAAGA Locus tag: Mmol_0753 Name: COG2301 Funciton: Citrate lyase beta subunit Locus tag: Mmol_0752 Name: COG2030 Funciton: Acyl dehydratase Locus tag: Mmol_0751 Name: citE Funciton: Citrate lyase beta chain (EC 4.1.3.6) Locus tag: Mmol_0750 Name: prpB Funciton: Methylisocitrate lyase (EC 4.1.3.30) Locus tag: Mmol_0749 Name: gltA Funciton: 2-methylcitrate synthase (EC 2.3.3.5)
	Mmol_0753	COG2301	Citrate lyase beta subunit
	Mmol_0752	COG2030	Acyl dehydratase
	Mmol_0751	citE	Citrate lyase beta chain (EC 4.1.3.6)
	Mmol_0750	prpB	Methylisocitrate lyase (EC 4.1.3.30)
	Mmol_0749	gltA	2-methylcitrate synthase (EC 2.3.3.5)
Position: -115 Score: 7.4 Sequence: TCTTATGTCTTATATAAGATATAAAA Locus tag: Mmol_0754 Name: sdhR Funciton: Transcriptional regulator of TCA cycle, GntR family Locus tag: Mmol_0755 Name: null Funciton: hypothetical protein Locus tag: Mmol_0756 Name: MB2181_04035 Funciton: Malate dehydrogenase (oxaloacetate-decarboxylating) (NADP(+)) Locus tag: Mmol_0757 Name: sdhC Funciton: Succinate dehydrogenase cytochrome b-556 subunit Locus tag: Mmol_0758 Name: sdhD Funciton: Succinate dehydrogenase, hydrophobic subunit, cytochrome b556 Locus tag: Mmol_0759 Name: sdhA Funciton: Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) Locus tag: Mmol_0760 Name: sdhB Funciton: Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) Locus tag: Mmol_0761 Name: COG2938 Funciton: succinate dehydrogenase iron-sulfur subunit Locus tag: Mmol_0762 Name: citE Funciton: Citrate lyase beta chain (EC 4.1.3.6) Locus tag: Mmol_0763 Name: MB2181_04000 Funciton: acetyl-coenzyme A synthetase family protein Locus tag: Mmol_0764 Name: fumA Funciton: Fumarate hydratase class I (EC 4.2.1.2) Locus tag: Mmol_0765 Name: null Funciton: hypothetical protein Locus tag: Mmol_0766 Name: acnB Funciton: Aconitate hydratase (EC 4.2.1.3)
	Mmol_0754	sdhR	Transcriptional regulator of TCA cycle, GntR family
	Mmol_0755		hypothetical protein
	Mmol_0756	MB2181_04035	Malate dehydrogenase (oxaloacetate-decarboxylating) (NADP(+))
	Mmol_0757	sdhC	Succinate dehydrogenase cytochrome b-556 subunit
	Mmol_0758	sdhD	Succinate dehydrogenase, hydrophobic subunit, cytochrome b556
	Mmol_0759	sdhA	Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1)
	Mmol_0760	sdhB	Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
	Mmol_0761	COG2938	succinate dehydrogenase iron-sulfur subunit
	Mmol_0762	citE	Citrate lyase beta chain (EC 4.1.3.6)
	Mmol_0763	MB2181_04000	acetyl-coenzyme A synthetase family protein
	Mmol_0764	fumA	Fumarate hydratase class I (EC 4.2.1.2)
	Mmol_0765		hypothetical protein
	Mmol_0766	acnB	Aconitate hydratase (EC 4.2.1.3)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of SdhR in Methylotenera mobilis JLW8

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --