Regulon of SO1578 in Shewanella loihica PV-4

Properties
Regulator type:	Transcription factor
TF locus tag:	Shew_2729
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Glutathione metabolism
Effector:
Regulog:	SO1578 - Shewanellaceae
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 24 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - TetR
By pathway - Glutathione metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -101 Score: 5.6 Sequence: TTAACTGAACGCTCGTTTAG Position: -66 Score: 6.1 Sequence: ATAACTGAACGTTCGGTCAA Locus tag: Shew_2729 Name: SO1578 Funciton: Transcriptional regulator, TetR family
	Shew_2729	SO1578	Transcriptional regulator, TetR family
Position: -114 Score: 6.1 Sequence: TTGACCGAACGTTCAGTTAT Position: -79 Score: 5.6 Sequence: CTAAACGAGCGTTCAGTTAA Locus tag: Shew_2730 Name: SO1577 Funciton: Glutathione S-transferase (EC 2.5.1.18)
	Shew_2730	SO1577	Glutathione S-transferase (EC 2.5.1.18)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD