Regulon of TrpR in Francisella tularensis subsp. tularensis SCHU S4

Properties
Regulator type:	Transcription factor
TF locus tag:	FTT_1803c
Regulator family:	TrpR
Regulation mode:	repressor
Biological process:	Tryptophan biosynthesis
Effector:	Tryptophan
Regulog:	TrpR - Francisellaceae
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By trascription factor - TrpR
By taxonomy - Francisellaceae
By TF family - TrpR
By effector - Tryptophan
By pathway - Tryptophan biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -46 Score: 7.2 Sequence: TGTAATGGTATAACATTACA Locus tag: FTT_1803c Name: trpR Funciton: trp operon repressor Locus tag: FTT_1802c Name: trpE Funciton: Anthranilate synthase, aminase component (EC 4.1.3.27)
	FTT_1803c	trpR	trp operon repressor
	FTT_1802c	trpE	Anthranilate synthase, aminase component (EC 4.1.3.27)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD