Regulog TrpR - Francisellaceae

Properties
Regulator type:	Transcription factor
Regulator family:	TrpR
Regulation mode:	repressor
Biological process:	Tryptophan biosynthesis
Effector:	Tryptophan
Phylum:	Proteobacteria/Gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By trascription factor - TrpR
By taxonomy - Francisellaceae
By TF family - TrpR
By effector - Tryptophan
By pathway - Tryptophan biosynthesis

Statistics of regulated genes
Genome	Genes	Operons
Francisella novicida FTE	10	1
Francisella philomiragia subsp. philomiragia ATCC 25017	7	1
Francisella tularensis subsp. tularensis SCHU S4	2	1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes				Function

CRON 1.
trpR	* Francisella novicida FTE Site: position = -46 score = 7.10523 sequence = TGTAATGGTGTAACATTACA Gene: FTE_0288: trp operon repressor	* Francisella philomiragia subsp. philomiragia ATCC 25017 Site: position = -45 score = 7.002 sequence = TGTAATGATGTACCATTACA Gene: Fphi_0840: trp operon repressor	* Francisella tularensis subsp. tularensis SCHU S4 Site: position = -46 score = 7.22039 sequence = TGTAATGGTATAACATTACA Gene: FTT_1803c: trp operon repressor	trp operon repressor
trpE	Francisella novicida FTE Gene: FTE_0287: Anthranilate synthase, aminase component (EC 4.1.3.27)	Francisella philomiragia subsp. philomiragia ATCC 25017 Gene: Fphi_0839: Anthranilate synthase, aminase component (EC 4.1.3.27)	Francisella tularensis subsp. tularensis SCHU S4 Gene: FTT_1802c: Anthranilate synthase, aminase component (EC 4.1.3.27)	Anthranilate synthase, aminase component (EC 4.1.3.27)
trpD_a	Francisella novicida FTE Gene: FTE_0286: Anthranilate synthase, amidotransferase component (EC 4.1.3.27)	Francisella philomiragia subsp. philomiragia ATCC 25017 Gene: Fphi_0838: Anthranilate synthase, amidotransferase component (EC 4.1.3.27)	Francisella tularensis subsp. tularensis SCHU S4	Anthranilate synthase, amidotransferase component (EC 4.1.3.27)
trpD_b	Francisella novicida FTE Gene: FTE_0285: Anthranilate phosphoribosyltransferase (EC 2.4.2.18)	Francisella philomiragia subsp. philomiragia ATCC 25017 Gene: Fphi_0837: Anthranilate phosphoribosyltransferase (EC 2.4.2.18)	Francisella tularensis subsp. tularensis SCHU S4	Anthranilate phosphoribosyltransferase (EC 2.4.2.18)
FTE_0284	Francisella novicida FTE Gene: FTE_0284: hypothetical protein	Francisella philomiragia subsp. philomiragia ATCC 25017	Francisella tularensis subsp. tularensis SCHU S4 Gene: FTT_1800c: hypothetical protein	hypothetical protein
FTE_0283	Francisella novicida FTE Gene: FTE_0283: hypothetical protein	Francisella philomiragia subsp. philomiragia ATCC 25017 Gene: Fphi_1599: hypothetical protein	Francisella tularensis subsp. tularensis SCHU S4	hypothetical protein
FTE_0282	Francisella novicida FTE Gene: FTE_0282: hypothetical protein	Francisella philomiragia subsp. philomiragia ATCC 25017 Gene: Fphi_1600: hypothetical protein	Francisella tularensis subsp. tularensis SCHU S4 Gene: FTT_1798c: hypothetical protein	hypothetical protein
msrA	Francisella novicida FTE Gene: FTE_0281: Peptide methionine sulfoxide reductase (EC 1.8.4.11)	Francisella philomiragia subsp. philomiragia ATCC 25017 Gene: Fphi_0836: Peptide methionine sulfoxide reductase (EC 1.8.4.11)	Francisella tularensis subsp. tularensis SCHU S4 Gene: FTT_1797c: Peptide methionine sulfoxide reductase (EC 1.8.4.11)	Peptide methionine sulfoxide reductase (EC 1.8.4.11)
FTE_0280	Francisella novicida FTE Gene: FTE_0280: hypothetical protein	Francisella philomiragia subsp. philomiragia ATCC 25017 Gene: Fphi_0835: hypothetical protein	Francisella tularensis subsp. tularensis SCHU S4 Gene: FTT_1796c: hypothetical protein	hypothetical protein
trpC	Francisella novicida FTE Gene: FTE_0278: Indole-3-glycerol phosphate synthase (EC 4.1.1.48) / Phosphoribosylanthranilate isomerase (EC 5.3.1.24)	Francisella philomiragia subsp. philomiragia ATCC 25017 Gene: Fphi_0834: Indole-3-glycerol phosphate synthase (EC 4.1.1.48) / Phosphoribosylanthranilate isomerase (EC 5.3.1.24)	Francisella tularensis subsp. tularensis SCHU S4 Gene: FTT_1795c: Indole-3-glycerol phosphate synthase (EC 4.1.1.48) / Phosphoribosylanthranilate isomerase (EC 5.3.1.24)	Indole-3-glycerol phosphate synthase (EC 4.1.1.48) / Phosphoribosylanthranilate isomerase (EC 5.3.1.24)

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog TrpR - Francisellaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --