Regulon of TrpR in Chlamydia trachomatis D/UW-3/CX

Properties
Regulator type:	Transcription factor
TF locus tag:	CT169
Regulator family:	TrpR
Regulation mode:	repressor
Biological process:	Tryptophan biosynthesis
Effector:	Tryptophan
Regulog:	TrpR - Chlamydiales
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By trascription factor - TrpR
By taxonomy - Chlamydiales
By TF family - TrpR
By effector - Tryptophan
By pathway - Tryptophan biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -32 Score: 6.8 Sequence: TGTAATATTATAGCATTACA Locus tag: CT169 Name: trpR Funciton: trp operon repressor Locus tag: CT170 Name: trpB Funciton: Tryptophan synthase beta chain (EC 4.2.1.20) Locus tag: CT171 Name: trpA Funciton: Tryptophan synthase alpha chain (EC 4.2.1.20)
	CT169	trpR	trp operon repressor
	CT170	trpB	Tryptophan synthase beta chain (EC 4.2.1.20)
	CT171	trpA	Tryptophan synthase alpha chain (EC 4.2.1.20)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD