Regulon of ModE2 in Leeuwenhoekiella blandensis MED217

Properties
Regulator type:	Transcription factor
TF locus tag:	MED217_08760
Regulator family:	ModE
Regulation mode:
Biological process:	Molybdopterin biosynthesis
Effector:	Molybdate
Regulog:	ModE2 - Flavobacteria
Statistics of regulated genes:
- Genes	8
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By trascription factor - ModE
By taxonomy - Flavobacteria
By TF family - ModE
By effector - Molybdate
By pathway - Molybdopterin biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -33 Score: 6.8 Sequence: CGTTATATTCGCTAAAACATAACG Locus tag: MED217_08765 Name: moeA Funciton: Molybdopterin biosynthesis protein MoeA Locus tag: MED217_08760 Name: modE2 Funciton: Molybdate-responsive transcriptional regulator ModE2, ModE family Locus tag: MED217_08755 Name: mobA Funciton: Molybdopterin-guanine dinucleotide biosynthesis protein MobA Locus tag: MED217_08750 Name: moaD Funciton: Molybdenum cofactor biosynthesis protein MoaD Locus tag: MED217_08745 Name: moeB Funciton: Molybdopterin biosynthesis protein MoeB Locus tag: MED217_08740 Name: moaE Funciton: Molybdenum cofactor biosynthesis protein MoaE Locus tag: MED217_08735 Name: moaCB Funciton: Molybdenum cofactor biosynthesis fusion protein MoaC/MoaB Locus tag: MED217_08730 Name: moaA Funciton: Molybdenum cofactor biosynthesis protein MoaA
	MED217_08765	moeA	Molybdopterin biosynthesis protein MoeA
	MED217_08760	modE2	Molybdate-responsive transcriptional regulator ModE2, ModE family
	MED217_08755	mobA	Molybdopterin-guanine dinucleotide biosynthesis protein MobA
	MED217_08750	moaD	Molybdenum cofactor biosynthesis protein MoaD
	MED217_08745	moeB	Molybdopterin biosynthesis protein MoeB
	MED217_08740	moaE	Molybdenum cofactor biosynthesis protein MoaE
	MED217_08735	moaCB	Molybdenum cofactor biosynthesis fusion protein MoaC/MoaB
	MED217_08730	moaA	Molybdenum cofactor biosynthesis protein MoaA

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD