Regulon of ModE2 in Gramella forsetii KT0803

Properties
Regulator type:	Transcription factor
TF locus tag:	orf440
Regulator family:	ModE
Regulation mode:
Biological process:	Molybdopterin biosynthesis
Effector:	Molybdate
Regulog:	ModE2 - Flavobacteria
Statistics of regulated genes:
- Genes	9
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By trascription factor - ModE
By taxonomy - Flavobacteria
By TF family - ModE
By effector - Molybdate
By pathway - Molybdopterin biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -33 Score: 6.8 Sequence: CGATATATATACAAATACATAACG Locus tag: orf441 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7) Locus tag: orf442 Name: orf442 Funciton: Putative dehydrogenase Locus tag: orf443 Name: null Funciton: Molybdopterin-guanine dinucleotide biosynthesis protein MobA Locus tag: orf444 Name: moaD Funciton: Molybdenum cofactor biosynthesis protein MoaD Locus tag: orf445 Name: moeB Funciton: Molybdopterin biosynthesis protein MoeB Locus tag: orf446 Name: moaE Funciton: Molybdenum cofactor biosynthesis protein MoaE Locus tag: orf447 Name: moaCB Funciton: Molybdenum cofactor biosynthesis fusion protein MoaC/MoaB Locus tag: orf448 Name: moaA Funciton: Molybdenum cofactor biosynthesis protein MoaA Locus tag: orf449 Name: moeA Funciton: Molybdopterin biosynthesis protein MoeA
	orf441	iscS	Cysteine desulfurase (EC 2.8.1.7)
	orf442	orf442	Putative dehydrogenase
	orf443		Molybdopterin-guanine dinucleotide biosynthesis protein MobA
	orf444	moaD	Molybdenum cofactor biosynthesis protein MoaD
	orf445	moeB	Molybdopterin biosynthesis protein MoeB
	orf446	moaE	Molybdenum cofactor biosynthesis protein MoaE
	orf447	moaCB	Molybdenum cofactor biosynthesis fusion protein MoaC/MoaB
	orf448	moaA	Molybdenum cofactor biosynthesis protein MoaA
	orf449	moeA	Molybdopterin biosynthesis protein MoeA

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD