Regulon of ModE3 in Bordetella petrii DSM 12804

Properties
Regulator type:	Transcription factor
TF locus tag:	Bpet4656
Regulator family:	ModE
Regulation mode:
Biological process:	Tungsten homeostasis
Effector:	Tungsten
Regulog:	ModE3 - Alcaligenaceae
Statistics of regulated genes:
- Genes	11
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By trascription factor - ModE
By taxonomy - Alcaligenaceae
By TF family - ModE
By effector - Tungsten
By pathway - Tungsten homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -74 Score: 6.1 Sequence: CTATGCAAAGTTATTCATAT Locus tag: Bpet4655 Name: tupA Funciton: Tungstate ABC-type transporter, permease protein Locus tag: Bpet4654 Name: tupC Funciton: Tungstate ABC-type transporter, ATP-binding protein Locus tag: Bpet4653 Name: tupB Funciton: Tungstate ABC-type transporter, substrate-binding protein
	Bpet4655	tupA	Tungstate ABC-type transporter, permease protein
	Bpet4654	tupC	Tungstate ABC-type transporter, ATP-binding protein
	Bpet4653	tupB	Tungstate ABC-type transporter, substrate-binding protein
Position: -67 Score: 6.1 Sequence: ATATGAATAACTTTGCATAG Locus tag: Bpet4656 Name: modE3 Funciton: Molybdate-responsive transcriptional regulator ModE
	Bpet4656	modE3	Molybdate-responsive transcriptional regulator ModE
Position: -2 Score: 6.2 Sequence: GTATGCAAAGCATTTCATAT Locus tag: Bpet4663 Name: fdoX Funciton: Putative subunit of formate dehydrogenase Locus tag: Bpet4662 Name: fdoG Funciton: Formate dehydrogenase-O, major subunit (EC 1.2.1.2) Locus tag: Bpet4661 Name: fdoH Funciton: Formate dehydrogenase-O, iron-sulfur subunit (EC 1.2.1.2) Locus tag: Bpet4660 Name: fdoY Funciton: Putative subunit of formate dehydrogenase Locus tag: Bpet4659 Name: fdoI Funciton: Formate dehydrogenase-O, gamma subunit (EC 1.2.1.2) Locus tag: Bpet4658 Name: fdoZ Funciton: Putative subunit of formate dehydrogenase Locus tag: Bpet4657 Name: fdhD Funciton: Formate dehydrogenase chain D (EC 1.2.1.2)
	Bpet4663	fdoX	Putative subunit of formate dehydrogenase
	Bpet4662	fdoG	Formate dehydrogenase-O, major subunit (EC 1.2.1.2)
	Bpet4661	fdoH	Formate dehydrogenase-O, iron-sulfur subunit (EC 1.2.1.2)
	Bpet4660	fdoY	Putative subunit of formate dehydrogenase
	Bpet4659	fdoI	Formate dehydrogenase-O, gamma subunit (EC 1.2.1.2)
	Bpet4658	fdoZ	Putative subunit of formate dehydrogenase
	Bpet4657	fdhD	Formate dehydrogenase chain D (EC 1.2.1.2)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD