Regulon of ModE3 in Bordetella bronchiseptica RB50

Properties
Regulator type:	Transcription factor
TF locus tag:	BB2126
Regulator family:	ModE
Regulation mode:
Biological process:	Tungsten homeostasis
Effector:	Tungsten
Regulog:	ModE3 - Alcaligenaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By trascription factor - ModE
By taxonomy - Alcaligenaceae
By TF family - ModE
By effector - Tungsten
By pathway - Tungsten homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -81 Score: 6.1 Sequence: CTATGCAATTCGTTTCATAT Locus tag: BB2127 Name: tupA Funciton: Tungstate ABC-type transporter, permease protein Locus tag: BB2128 Name: tupC Funciton: Tungstate ABC-type transporter, ATP-binding protein Locus tag: BB2129 Name: tupB Funciton: Tungstate ABC-type transporter, substrate-binding protein
	BB2127	tupA	Tungstate ABC-type transporter, permease protein
	BB2128	tupC	Tungstate ABC-type transporter, ATP-binding protein
	BB2129	tupB	Tungstate ABC-type transporter, substrate-binding protein
Position: -100 Score: 6.1 Sequence: ATATGAAACGAATTGCATAG Locus tag: BB2126 Name: modE3 Funciton: Molybdate-responsive transcriptional regulator ModE
	BB2126	modE3	Molybdate-responsive transcriptional regulator ModE

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD