Regulon of FdsR in Methylibium petroleiphilum PM1

Properties
Regulator type:	Transcription factor
TF locus tag:	Mpe_A3707, Mpe_A0339
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Formate oxydation
Effector:	Formate
Regulog:	FdsR - Comamonadaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Comamonadaceae
By TF family - ModE
By effector - Formate
By pathway - Formate oxydation

Regulated operons
	Locus Tag	Name	Function
Position: -28 Score: 5.8 Sequence: ATATGCGCTGAAGCGCCGAA Locus tag: Mpe_A3707 Name: fdsR Funciton: Formate dehydrogenase transcriptional regulator FdsR, ModE family
	Mpe_A3707	fdsR	Formate dehydrogenase transcriptional regulator FdsR, ModE family
Position: -167 Score: 5.8 Sequence: TTCGGCGCTTCAGCGCATAT Locus tag: Mpe_A3708 Name: fdsG Funciton: NAD-dependent formate dehydrogenase (EC 1.2.1.2), gamma subunit Locus tag: Mpe_A3709 Name: fdsB Funciton: NAD-dependent formate dehydrogenase (EC 1.2.1.2), beta subunit Locus tag: Mpe_A3710 Name: fdsA Funciton: NAD-dependent formate dehydrogenase (EC 1.2.1.2), alpha subunit
	Mpe_A3708	fdsG	NAD-dependent formate dehydrogenase (EC 1.2.1.2), gamma subunit
	Mpe_A3709	fdsB	NAD-dependent formate dehydrogenase (EC 1.2.1.2), beta subunit
	Mpe_A3710	fdsA	NAD-dependent formate dehydrogenase (EC 1.2.1.2), alpha subunit

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD