Regulon of ModE in Rhodobacter sphaeroides 2.4.1

Properties
Regulator type:	Transcription factor
TF locus tag:	RSP_3874
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdopterin biosynthesis
Effector:	Molybdate
Regulog:	ModE - Rhodobacterales
Statistics of regulated genes:
- Genes	4
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By trascription factor - ModE
By taxonomy - Rhodobacterales
By TF family - ModE
By effector - Molybdate
By pathway - Molybdopterin biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -32 Score: 5.4 Sequence: TTATGCATTCAGCATATATAT Locus tag: RSP_3874 Name: modE Funciton: Molybdate-responsive transcriptional regulator ModE Locus tag: RSP_3873 Name: modD Funciton: Molybdenum transport system protein ModD
	RSP_3874	modE	Molybdate-responsive transcriptional regulator ModE
	RSP_3873	modD	Molybdenum transport system protein ModD
Position: -135 Score: 5.3 Sequence: TTATGTAGTCGAGAAACATAG Locus tag: RSP_2501 Name: modD Funciton: Molybdenum transport system protein ModD
	RSP_2501	modD	Molybdenum transport system protein ModD
Position: -78 Score: 6.2 Sequence: ATATGTAGTTCGAATACATAA Locus tag: RSP_3871 Name: modA Funciton: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
	RSP_3871	modA	Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD