Regulog ModE - Rhodobacterales
| Regulator type: | Transcription factor |
| Regulator family: | ModE |
| Regulation mode: | repressor (activator) |
| Biological process: | Molybdopterin biosynthesis |
| Effector: | Molybdate |
| Phylum: | Proteobacteria/Apha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - ModE
- By taxonomy - Rhodobacterales
- By TF family - ModE
- By effector - Molybdate
- By pathway - Molybdopterin biosynthesis
| Genome | Genes | Operons |
|---|---|---|
| Hyphomonas neptunium ATCC 15444 | ||
| Jannaschia sp. CCS1 | ||
| Loktanella vestfoldensis SKA53 | ||
| Oceanicaulis alexandrii HTCC2633 | ||
| Oceanicola batsensis HTCC2597 | ||
| Oceanicola granulosus HTCC2516 | ||
| Paracoccus denitrificans PD1222 | ||
| Rhodobacter sphaeroides 2.4.1 | 4 | 3 |
| Rhodobacterales bacterium HTCC2654 | ||
| Roseobacter sp. MED193 | ||
| Roseovarius nubinhibens ISM | ||
| Roseovarius sp. 217 | ||
| Silicibacter TM1040 | ||
| Silicibacter pomeroyi DSS-3 | ||
| Sulfitobacter sp. EE-36 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| modE |
|
|
|
|
|
|
|
*
Rhodobacter sphaeroides 2.4.1 Site: position = -32 score = 5.39117 sequence = TTATGCATTCAGCATATATAT Gene: RSP_3874: Molybdate-responsive transcriptional regulator ModE |
|
|
|
|
|
|
|
Molybdate-responsive transcriptional regulator ModE |
| modD |
|
|
|
|
|
|
|
*2
Rhodobacter sphaeroides 2.4.1 Site: position = -135 score = 5.25012 sequence = TTATGTAGTCGAGAAACATAG Gene: RSP_2501: Molybdenum transport system protein ModD Gene: RSP_3873: Molybdenum transport system protein ModD |
|
|
|
|
|
|
|
Molybdenum transport system protein ModD |
| CRON 2. | ||||||||||||||||
| modA |
|
Gene: Jann_2470: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) |
Gene: SKA53_00974: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) |
|
Gene: OB2597_06555: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) |
|
Gene: Pden_2665: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) |
*
Rhodobacter sphaeroides 2.4.1 Site: position = -78 score = 6.15512 sequence = ATATGTAGTTCGAATACATAA Gene: RSP_3871: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) |
Gene: RB2654_14140: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) |
Gene: MED193_01635: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) |
Gene: ISM_01355: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) |
|
Gene: TM1040_3664: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) |
Gene: SPO0699: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) |
Gene: EE36_03318: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) |
Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |