Regulog ModE - Rhodobacterales

Properties
Regulator type:	Transcription factor
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdopterin biosynthesis
Effector:	Molybdate
Phylum:	Proteobacteria/Apha
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By trascription factor - ModE
By taxonomy - Rhodobacterales
By TF family - ModE
By effector - Molybdate
By pathway - Molybdopterin biosynthesis

Statistics of regulated genes
Genome	Genes	Operons
Hyphomonas neptunium ATCC 15444
Jannaschia sp. CCS1
Loktanella vestfoldensis SKA53
Oceanicaulis alexandrii HTCC2633
Oceanicola batsensis HTCC2597
Oceanicola granulosus HTCC2516
Paracoccus denitrificans PD1222
Rhodobacter sphaeroides 2.4.1	4	3
Rhodobacterales bacterium HTCC2654
Roseobacter sp. MED193
Roseovarius nubinhibens ISM
Roseovarius sp. 217
Silicibacter TM1040
Silicibacter pomeroyi DSS-3
Sulfitobacter sp. EE-36

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes																Function

CRON 1.
modE	Hyphomonas neptunium ATCC 15444	Jannaschia sp. CCS1	Loktanella vestfoldensis SKA53	Oceanicaulis alexandrii HTCC2633	Oceanicola batsensis HTCC2597	Oceanicola granulosus HTCC2516	Paracoccus denitrificans PD1222	* Rhodobacter sphaeroides 2.4.1 Site: position = -32 score = 5.39117 sequence = TTATGCATTCAGCATATATAT Gene: RSP_3874: Molybdate-responsive transcriptional regulator ModE	Rhodobacterales bacterium HTCC2654	Roseobacter sp. MED193	Roseovarius nubinhibens ISM	Roseovarius sp. 217	Silicibacter TM1040	Silicibacter pomeroyi DSS-3	Sulfitobacter sp. EE-36	Molybdate-responsive transcriptional regulator ModE
modD	Hyphomonas neptunium ATCC 15444	Jannaschia sp. CCS1	Loktanella vestfoldensis SKA53	Oceanicaulis alexandrii HTCC2633	Oceanicola batsensis HTCC2597	Oceanicola granulosus HTCC2516	Paracoccus denitrificans PD1222	2 Rhodobacter sphaeroides 2.4.1* Site: position = -135 score = 5.25012 sequence = TTATGTAGTCGAGAAACATAG Gene: RSP_2501: Molybdenum transport system protein ModD Gene: RSP_3873: Molybdenum transport system protein ModD	Rhodobacterales bacterium HTCC2654	Roseobacter sp. MED193	Roseovarius nubinhibens ISM	Roseovarius sp. 217	Silicibacter TM1040	Silicibacter pomeroyi DSS-3	Sulfitobacter sp. EE-36	Molybdenum transport system protein ModD

CRON 2.
modA	Hyphomonas neptunium ATCC 15444	Jannaschia sp. CCS1 Gene: Jann_2470: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)	Loktanella vestfoldensis SKA53 Gene: SKA53_00974: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)	Oceanicaulis alexandrii HTCC2633	Oceanicola batsensis HTCC2597 Gene: OB2597_06555: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)	Oceanicola granulosus HTCC2516	Paracoccus denitrificans PD1222 Gene: Pden_2665: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)	* Rhodobacter sphaeroides 2.4.1 Site: position = -78 score = 6.15512 sequence = ATATGTAGTTCGAATACATAA Gene: RSP_3871: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)	Rhodobacterales bacterium HTCC2654 Gene: RB2654_14140: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)	Roseobacter sp. MED193 Gene: MED193_01635: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)	Roseovarius nubinhibens ISM Gene: ISM_01355: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)	Roseovarius sp. 217	Silicibacter TM1040 Gene: TM1040_3664: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)	Silicibacter pomeroyi DSS-3 Gene: SPO0699: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)	Sulfitobacter sp. EE-36 Gene: EE36_03318: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)	Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog ModE - Rhodobacterales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --