Regulon of ModE in Rhodopseudomonas palustris CGA009

Properties
Regulator type:	Transcription factor
TF locus tag:	RPA0147, RPA4718
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdopterin biosynthesis
Effector:	Molybdate
Regulog:	ModE - Rhizobiales
Statistics of regulated genes:
- Genes	10
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By trascription factor - ModE
By taxonomy - Rhizobiales
By TF family - ModE
By effector - Molybdate
By pathway - Molybdopterin biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -54 Score: 4.5 Sequence: TTATATAGTTCTTGCATATGA Locus tag: RPA4718 Name: modE Funciton: Molybdate-responsive transcriptional regulator ModE Locus tag: RPA4717 Name: modA Funciton: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) Locus tag: RPA4716 Name: modB Funciton: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1) Locus tag: RPA4715 Name: modC Funciton: Molybdate ABC transporter, ATP-binding protein
	RPA4718	modE	Molybdate-responsive transcriptional regulator ModE
	RPA4717	modA	Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
	RPA4716	modB	Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
	RPA4715	modC	Molybdate ABC transporter, ATP-binding protein
Position: -79 Score: 5.2 Sequence: TTGTTTACTCAGATTACATAT Locus tag: RPA0152 Name: RPA0152 Funciton: Hypothetical protein Locus tag: RPA0151 Name: RPA0151 Funciton: Putative ABC transporter, substrate-binding protein Locus tag: RPA0150 Name: RPA0150 Funciton: Putative ABC transporter, permease protein Locus tag: RPA0149 Name: RPA0149 Funciton: Putative ABC transporter, ATP-binding protein Locus tag: RPA0148 Name: modC2 Funciton: ABC-type molybdate transport system, ATP-binding protein Locus tag: RPA0147 Name: modE Funciton: Molybdate-responsive transcriptional regulator ModE
	RPA0152	RPA0152	Hypothetical protein
	RPA0151	RPA0151	Putative ABC transporter, substrate-binding protein
	RPA0150	RPA0150	Putative ABC transporter, permease protein
	RPA0149	RPA0149	Putative ABC transporter, ATP-binding protein
	RPA0148	modC2	ABC-type molybdate transport system, ATP-binding protein
	RPA0147	modE	Molybdate-responsive transcriptional regulator ModE

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD