Profile of regulator ModE in Rhizobiales
| Regulator family: | ModE |
| Regulation mode: | repressor (activator) |
| Biological process: | Molybdopterin biosynthesis |
| Effector: | Molybdate |
| Regulog: | ModE - Rhizobiales |
Member of regulog collections
- By trascription factor - ModE
- By taxonomy - Rhizobiales
- By TF family - ModE
- By effector - Molybdate
- By pathway - Molybdopterin biosynthesis
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Rhodopseudomonas palustris CGA009 | |||||
| RPA0152 | RPA0152 | -79 | 5.2 | TTGTTTACTCAGATTACATAT | |
| RPA4718 | modE | -54 | 4.5 | TTATATAGTTCTTGCATATGA | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |