Regulon of NrtR in Streptomyces scabiei 87.22

Properties
Regulator type:	Transcription factor
TF locus tag:	SCAB_71891, SCAB_24481
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Regulog:	NrtR - Streptomycetaceae
Statistics of regulated genes:
- Genes	7
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 19 sites [see more]

Member of regulog collections

By trascription factor - NrtR
By taxonomy - Streptomycetaceae
By TF family - NrtR
By effector - Adenosine diphosphate ribose
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -92 Score: 4.7 Sequence: ATCTCGTCCCCTTGACGATAA Position: -59 Score: 5.5 Sequence: TTATCGTCTGAGTGACACTAA Locus tag: SCAB_23161 Name: orfX Funciton: NrtR-regulated hypothetical OrfX Locus tag: SCAB_23171 Name: orfY Funciton: NrtR-regulated hypothetical OrfY
	SCAB_23161	orfX	NrtR-regulated hypothetical OrfX
	SCAB_23171	orfY	NrtR-regulated hypothetical OrfY
Position: -52 Score: 6.2 Sequence: TTATAGTCGTTCTGACTATTA Position: -36 Score: 5.5 Sequence: TATTAGTCATGGTGACCATAA Locus tag: SCAB_71891 Name: nrtR1 Funciton: Nudix-related transcriptional regulator NrtR Locus tag: SCAB_71901 Name: draG Funciton: NrtR-regulated ADP-ribosyl-glycohydrolase DraG Locus tag: SCAB_71911 Name: PF10127 Funciton: Nucleotidyltransferase, predicted
	SCAB_71891	nrtR1	Nudix-related transcriptional regulator NrtR
	SCAB_71901	draG	NrtR-regulated ADP-ribosyl-glycohydrolase DraG
	SCAB_71911	PF10127	Nucleotidyltransferase, predicted
Position: -31 Score: 4.9 Sequence: TTATCGTCAGGCAGACGACTA Locus tag: SCAB_24481 Name: nrtR2 Funciton: Nudix-related transcriptional regulator NrtR
	SCAB_24481	nrtR2	Nudix-related transcriptional regulator NrtR
Position: -31 Score: 5 Sequence: ATAATGTCGCTCTGACGATTA Locus tag: SCAB_66451 Name: nadE Funciton: NAD synthetase (EC 6.3.1.5)
	SCAB_66451	nadE	NAD synthetase (EC 6.3.1.5)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD