Regulon of NrtR in Streptomyces griseus subsp. griseus NBRC 13350

Properties
Regulator type:	Transcription factor
TF locus tag:	SGR_5732, SGR_1704
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Regulog:	NrtR - Streptomycetaceae
Statistics of regulated genes:
- Genes	8
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 19 sites [see more]

Member of regulog collections

By trascription factor - NrtR
By taxonomy - Streptomycetaceae
By TF family - NrtR
By effector - Adenosine diphosphate ribose
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -70 Score: 6 Sequence: TAATAGTCACCTTGACTCTAA Position: -37 Score: 4.8 Sequence: TTATCGTCGCCATGACGAAAT Locus tag: SGR_831 Name: orfX Funciton: NrtR-regulated hypothetical OrfX Locus tag: SGR_832 Name: orfY Funciton: NrtR-regulated hypothetical OrfY
	SGR_831	orfX	NrtR-regulated hypothetical OrfX
	SGR_832	orfY	NrtR-regulated hypothetical OrfY
Position: -11 Score: 6.4 Sequence: TTATAGTCAGAGTGACTATTA Locus tag: SGR_5730 Name: pnuC Funciton: Ribosyl nicotinamide transporter, PnuC family Locus tag: SGR_5731 Name: nadR Funciton: Nicotinamide-nucleotide adenylyltransferase, NadR family (EC 2.7.7.1) / Ribosylnicotinamide kinase (EC 2.7.1.22) Locus tag: SGR_5732 Name: nrtR1 Funciton: Nudix-related transcriptional regulator NrtR Locus tag: SGR_5733 Name: draG Funciton: NrtR-regulated ADP-ribosyl-glycohydrolase DraG
	SGR_5730	pnuC	Ribosyl nicotinamide transporter, PnuC family
	SGR_5731	nadR	Nicotinamide-nucleotide adenylyltransferase, NadR family (EC 2.7.7.1) / Ribosylnicotinamide kinase (EC 2.7.1.22)
	SGR_5732	nrtR1	Nudix-related transcriptional regulator NrtR
	SGR_5733	draG	NrtR-regulated ADP-ribosyl-glycohydrolase DraG
Position: -31 Score: 4.9 Sequence: TTATCGTCAGGCAGACGACTA Locus tag: SGR_1704 Name: nrtR2 Funciton: Nudix-related transcriptional regulator NrtR
	SGR_1704	nrtR2	Nudix-related transcriptional regulator NrtR
Position: -32 Score: 4.4 Sequence: ATCGCGTCAGAAAGACGATTA Locus tag: SGR_5258 Name: nadE Funciton: NAD synthetase (EC 6.3.1.5)
	SGR_5258	nadE	NAD synthetase (EC 6.3.1.5)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD