Regulon of NrtR in Streptomyces coelicolor A3(2)

Properties
Regulator type:	Transcription factor
TF locus tag:	SCO1767, SCO5817
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Regulog:	NrtR - Streptomycetaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 19 sites [see more]

Member of regulog collections

By trascription factor - NrtR
By taxonomy - Streptomycetaceae
By TF family - NrtR
By effector - Adenosine diphosphate ribose
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -36 Score: 6.4 Sequence: TTATAGTCGCAGTGACTATTA Locus tag: SCO1767 Name: nrtR1 Funciton: Nudix-related transcriptional regulator NrtR Locus tag: SCO1766 Name: draG Funciton: NrtR-regulated ADP-ribosyl-glycohydrolase DraG Locus tag: SCO1765 Name: PF10127 Funciton: Nucleotidyltransferase, predicted
	SCO1767	nrtR1	Nudix-related transcriptional regulator NrtR
	SCO1766	draG	NrtR-regulated ADP-ribosyl-glycohydrolase DraG
	SCO1765	PF10127	Nucleotidyltransferase, predicted
Position: 41 Score: 4.4 Sequence: ATTGCGTCGTTCTGACGATTA Locus tag: SCO2238 Name: nadE Funciton: NAD synthetase (EC 6.3.1.5)
	SCO2238	nadE	NAD synthetase (EC 6.3.1.5)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD