Regulon of NrtR in Renibacterium salmoninarum ATCC 33209

Properties
Regulator type:	Transcription factor
TF locus tag:	RSal33209_1516
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Regulog:	NrtR - Micrococcineae
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By trascription factor - NrtR
By taxonomy - Micrococcineae
By TF family - NrtR
By effector - Adenosine diphosphate ribose
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -11 Score: 6.3 Sequence: TTAAAGTCAAAATGACTATAA Locus tag: RSal33209_1516 Name: nrtR Funciton: Nudix-related transcriptional regulator NrtR Locus tag: RSal33209_1517 Name: nadA Funciton: Quinolinate synthetase (EC 4.1.99.-) Locus tag: RSal33209_1518 Name: nadB Funciton: L-aspartate oxidase (EC 1.4.3.16) Locus tag: RSal33209_1519 Name: nadB Funciton: L-aspartate oxidase (EC 1.4.3.16)
	RSal33209_1516	nrtR	Nudix-related transcriptional regulator NrtR
	RSal33209_1517	nadA	Quinolinate synthetase (EC 4.1.99.-)
	RSal33209_1518	nadB	L-aspartate oxidase (EC 1.4.3.16)
	RSal33209_1519	nadB	L-aspartate oxidase (EC 1.4.3.16)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD