Regulon of NrtR in Brachybacterium faecium DSM 4810

Properties
Regulator type:	Transcription factor
TF locus tag:	Bfae_03740
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Regulog:	NrtR - Micrococcineae
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By trascription factor - NrtR
By taxonomy - Micrococcineae
By TF family - NrtR
By effector - Adenosine diphosphate ribose
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -72 Score: 4.7 Sequence: TTCTGGTCACCGTGAGACTAA Position: -36 Score: 5.6 Sequence: TAAAGGTCAACGCGACTTTAA Locus tag: Bfae_03740 Name: nrtR Funciton: Nudix-related transcriptional regulator NrtR Locus tag: Bfae_03750 Name: nadA Funciton: Quinolinate synthetase (EC 4.1.99.-) Locus tag: Bfae_03760 Name: nadB Funciton: L-aspartate oxidase (EC 1.4.3.16) Locus tag: Bfae_03770 Name: nadC Funciton: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19) Locus tag: Bfae_03780 Name: sufS Funciton: Cysteine desulfurase (EC 2.8.1.7)
	Bfae_03740	nrtR	Nudix-related transcriptional regulator NrtR
	Bfae_03750	nadA	Quinolinate synthetase (EC 4.1.99.-)
	Bfae_03760	nadB	L-aspartate oxidase (EC 1.4.3.16)
	Bfae_03770	nadC	Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
	Bfae_03780	sufS	Cysteine desulfurase (EC 2.8.1.7)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD