Regulon of ModE in Pelodictyon phaeoclathratiforme BU-1

Properties
Regulator type:	Transcription factor
TF locus tag:	Ppha_1986
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdopterin biosynthesis
Effector:	Molybdate
Regulog:	ModE - Chlorobiales
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 25 sites [see more]

Member of regulog collections

By trascription factor - ModE
By taxonomy - Chlorobiales
By TF family - ModE
By effector - Molybdate
By pathway - Molybdopterin biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -153 Score: 5.6 Sequence: TTCCGTTATATAATTTAGTAAACAACGTAT Position: -41 Score: 5.8 Sequence: TTTCGCTATATTTTTAAGGTAATAACGAAT Locus tag: Ppha_1997 Name: omp_mod Funciton: Predicted molybdenum transport TonB-dependent receptor Locus tag: Ppha_1998 Name: modA Funciton: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) Locus tag: Ppha_1999 Name: modB Funciton: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
	Ppha_1997	omp_mod	Predicted molybdenum transport TonB-dependent receptor
	Ppha_1998	modA	Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
	Ppha_1999	modB	Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
Position: -298 Score: 5.6 Sequence: ATACGTTGTTTACTAAATTATATAACGGAA Locus tag: Ppha_1996 Name: modX Funciton: Predicted molybdate-binding protein Locus tag: Ppha_1995 Name: modC Funciton: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
	Ppha_1996	modX	Predicted molybdate-binding protein
	Ppha_1995	modC	Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD