Regulon of ModE in Chloroherpeton thalassium ATCC 35110

Properties
Regulator type:	Transcription factor
TF locus tag:	Ctha_1482
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdopterin biosynthesis
Effector:	Molybdate
Regulog:	ModE - Chlorobiales
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 25 sites [see more]

Member of regulog collections

By trascription factor - ModE
By taxonomy - Chlorobiales
By TF family - ModE
By effector - Molybdate
By pathway - Molybdopterin biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -36 Score: 6 Sequence: TAACGATATATATTAAAGTATATAACGAAT Locus tag: Ctha_1484 Name: omp_mod Funciton: Predicted molybdenum transport TonB-dependent receptor
	Ctha_1484	omp_mod	Predicted molybdenum transport TonB-dependent receptor
Position: -32 Score: 5.9 Sequence: TTTCGTTATTTTCTCTTTGTTATAAGGCAA Locus tag: Ctha_2016 Name: modX Funciton: Predicted molybdate-binding protein Locus tag: Ctha_2015 Name: modC Funciton: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1) Locus tag: Ctha_2014 Name: modA Funciton: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) Locus tag: Ctha_2013 Name: modB Funciton: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
	Ctha_2016	modX	Predicted molybdate-binding protein
	Ctha_2015	modC	Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
	Ctha_2014	modA	Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
	Ctha_2013	modB	Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD