Regulon of ModE in Chlorobaculum parvum NCIB 8327

Properties
Regulator type:	Transcription factor
TF locus tag:	Cpar_1630
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdopterin biosynthesis
Effector:	Molybdate
Regulog:	ModE - Chlorobiales
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 25 sites [see more]

Member of regulog collections

By trascription factor - ModE
By taxonomy - Chlorobiales
By TF family - ModE
By effector - Molybdate
By pathway - Molybdopterin biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -90 Score: 6.1 Sequence: ATTCGTTATATTTGTAAGAACATAACGAAT Locus tag: Cpar_0441 Name: modX Funciton: Predicted molybdate-binding protein
	Cpar_0441	modX	Predicted molybdate-binding protein
Position: -151 Score: 6.4 Sequence: AATCGTTATTTCCTGTAAGACATATCGAAA Locus tag: Cpar_0446 Name: modD Funciton: Molybdenum transport system protein ModD Locus tag: Cpar_0445 Name: modA Funciton: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) Locus tag: Cpar_0444 Name: modB Funciton: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1) Locus tag: Cpar_0443 Name: modC Funciton: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
	Cpar_0446	modD	Molybdenum transport system protein ModD
	Cpar_0445	modA	Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
	Cpar_0444	modB	Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
	Cpar_0443	modC	Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD