Regulon of NrtR in Clostridium beijerincki NCIMB 8052

Properties
Regulator type:	Transcription factor
TF locus tag:	Cbei_2075
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Regulog:	NrtR - Clostridia-1
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By trascription factor - NrtR
By taxonomy - Clostridia-1
By TF family - NrtR
By effector - Adenosine diphosphate ribose
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -69 Score: 5.6 Sequence: ATAGAATCAAATTGATATTAT Locus tag: Cbei_2075 Name: nrtR Funciton: Nudix-related transcriptional regulator NrtR Locus tag: Cbei_2076 Name: prs Funciton: Ribose-phosphate pyrophosphokinase (EC 2.7.6.1)
	Cbei_2075	nrtR	Nudix-related transcriptional regulator NrtR
	Cbei_2076	prs	Ribose-phosphate pyrophosphokinase (EC 2.7.6.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD