Regulon of PhnR1 in Aeromonas hydrophila subsp. hydrophila ATCC 7966

Properties
Regulator type:	Transcription factor
TF locus tag:	AHA_3982
Regulator family:	GntR/Others
Regulation mode:
Biological process:	2-aminoethylphosphonate utilization
Effector:	2-aminoethylphosphonate
Regulog:	PhnR1 - Psychromonadaceae/Aeromonadales
Statistics of regulated genes:
- Genes	7
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Psychromonadaceae/Aeromonadales
By trascription factor - PhnR
By TF family - GntR/Others
By effector - 2-aminoethylphosphonate
By pathway - 2-aminoethylphosphonate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -294 Score: 5.9 Sequence: TTGCTGGAGTAGTCCAGCTT Position: -152 Score: 5.6 Sequence: TAACTGACCTAGTCCAGAGG Locus tag: AHA_3983 Name: phnS Funciton: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1) Locus tag: AHA_3984 Name: AHA_3984 Funciton: type I phosphodiesterase Locus tag: AHA_3985 Name: phnU Funciton: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1) Locus tag: AHA_3986 Name: phnV Funciton: 2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1) Locus tag: AHA_3987 Name: phnT Funciton: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1) Locus tag: AHA_3988 Name: COG0560 Funciton: Phosphoserine phosphatase (EC 3.1.3.3)
	AHA_3983	phnS	2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
	AHA_3984	AHA_3984	type I phosphodiesterase
	AHA_3985	phnU	2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1)
	AHA_3986	phnV	2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1)
	AHA_3987	phnT	2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
	AHA_3988	COG0560	Phosphoserine phosphatase (EC 3.1.3.3)
Position: -218 Score: 5.6 Sequence: CCTCTGGACTAGGTCAGTTA Position: -76 Score: 5.9 Sequence: AAGCTGGACTACTCCAGCAA Locus tag: AHA_3982 Name: null Funciton: 2-aminoethylphosphonate uptake and metabolism regulator, GntR family
	AHA_3982		2-aminoethylphosphonate uptake and metabolism regulator, GntR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD