Regulog PhnR1 - Psychromonadaceae/Aeromonadales
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | 2-aminoethylphosphonate utilization |
| Effector: | 2-aminoethylphosphonate |
| Phylum: | Proteobacteria/Gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Psychromonadaceae/Aeromonadales
- By trascription factor - PhnR
- By TF family - GntR/Others
- By effector - 2-aminoethylphosphonate
- By pathway - 2-aminoethylphosphonate utilization
| Genome | Genes | Operons |
|---|---|---|
| Aeromonas hydrophila subsp. hydrophila ATCC 7966 | 7 | 2 |
| Aeromonas salmonicida subsp. salmonicida A449 | 7 | 2 |
| Tolumonas auensis DSM 9187 | ||
| Moritella sp. PE36 | ||
| Psychromonas ingrahamii 37 | ||
| Psychromonas sp. CNPT3 |
| Genes | Function | ||||||
|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||
| phnR1 |
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -218 score = 5.55298 sequence = CCTCTGGACTAGGTCAGTTA Site: position = -76 score = 5.93331 sequence = AAGCTGGACTACTCCAGCAA Gene: AHA_3982: 2-aminoethylphosphonate uptake and metabolism regulator, GntR family |
*
Aeromonas salmonicida subsp. salmonicida A449 Site: position = -223 score = 5.55298 sequence = CCTCTGGACTAGGTCAGTTA Site: position = -82 score = 5.70632 sequence = ACGCTGGTCTACTCCAGCGG Gene: ASA_4028: 2-aminoethylphosphonate uptake and metabolism regulator, GntR family |
|
|
|
|
2-aminoethylphosphonate uptake and metabolism regulator, GntR family |
| CRON 2. | |||||||
| phnS |
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -294 score = 5.93331 sequence = TTGCTGGAGTAGTCCAGCTT Site: position = -152 score = 5.55298 sequence = TAACTGACCTAGTCCAGAGG Gene: AHA_3983: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1) |
*
Aeromonas salmonicida subsp. salmonicida A449 Site: position = -26 score = 5.55298 sequence = TAACTGACCTAGTCCAGAGG Site: position = -167 score = 5.70632 sequence = CCGCTGGAGTAGACCAGCGT Gene: ASA_4029: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1) |
|
Gene: PE36_07142: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1) |
|
|
2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1) |
| AHA_3984 |
Gene: AHA_3984: type I phosphodiesterase |
Gene: ASA_4030: type I phosphodiesterase |
|
Gene: PE36_07147: type I phosphodiesterase |
|
|
type I phosphodiesterase |
| phnU |
Gene: AHA_3985: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1) |
Gene: ASA_4031: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1) |
|
Gene: PE36_07152: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1) |
|
|
2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1) |
| phnV |
Gene: AHA_3986: 2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1) |
Gene: ASA_4032: 2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1) |
|
Gene: PE36_07157: 2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1) |
|
|
2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1) |
| phnT |
Gene: AHA_3987: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1) |
Gene: ASA_4033: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1) |
|
Gene: PE36_07162: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1) |
|
|
2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1) |
| COG0560 |
Gene: AHA_3988: Phosphoserine phosphatase (EC 3.1.3.3) |
Gene: ASA_4034: Phosphoserine phosphatase (EC 3.1.3.3) |
|
Gene: PE36_07167: Phosphoserine phosphatase (EC 3.1.3.3) |
|
|
Phosphoserine phosphatase (EC 3.1.3.3) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |