Regulon of CBO1205 in Clostridium tetani E88

Properties
Regulator type:	Transcription factor
TF locus tag:	CTC01687
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug efflux; Macrolides efflux
Effector:
Regulog:	CBO1205 - Clostridia-1
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-1
By TF family - GntR/Others
By pathway - Multidrug efflux
By pathway - Macrolides efflux

Regulated operons
	Locus Tag	Name	Function
Position: -39 Score: 6 Sequence: TATACTTAGTTATATTAGTAACTAACCAAT Locus tag: CTC01688 Name: null Funciton: hypothetical protein Locus tag: CTC01687 Name: CBO1205 Funciton: Transcriptional regulator, GntR family Locus tag: CTC01686 Name: null Funciton: hypothetical protein Locus tag: CTC01685 Name: lp_2743 Funciton: ABC-type multidrug transport system, ATPase component Locus tag: CTC01684 Name: null Funciton: hypothetical protein
	CTC01688		hypothetical protein
	CTC01687	CBO1205	Transcriptional regulator, GntR family
	CTC01686		hypothetical protein
	CTC01685	lp_2743	ABC-type multidrug transport system, ATPase component
	CTC01684		hypothetical protein
Position: -94 Score: 6.7 Sequence: TATAGTTAGTTATACATGTAACTAACCAAC Locus tag: CTC01397 Name: lp_2744 Funciton: ABC-type multidrug transport system, permease component
	CTC01397	lp_2744	ABC-type multidrug transport system, permease component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD