Regulog CBO1205 - Clostridia-1
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Multidrug efflux; Macrolides efflux |
| Effector: | |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Clostridia-1
- By TF family - GntR/Others
- By pathway - Multidrug efflux
- By pathway - Macrolides efflux
| Genome | Genes | Operons |
|---|---|---|
| Clostridium acetobutylicum ATCC 824 | ||
| Clostridium beijerincki NCIMB 8052 | ||
| Clostridium botulinum A str. ATCC 3502 | 3 | 1 |
| Clostridium butyricum 5521 | ||
| Clostridium kluyveri DSM 555 | ||
| Clostridium novyi NT | ||
| Clostridium perfringens ATCC 13124 | ||
| Clostridium tetani E88 | 6 | 2 |
| Genes | Function | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||
| CTC01688 |
|
|
|
|
|
|
|
*
Clostridium tetani E88 Site: position = -39 score = 5.96904 sequence = TATACTTAGTTATATTAGTAACTAACCAAT Gene: CTC01688: hypothetical protein |
hypothetical protein |
| CBO1205 |
|
|
*
Clostridium botulinum A str. ATCC 3502 Site: position = -50 score = 6.55364 sequence = TATAGTTAGTCATATAAGTAATTAACCAAC Gene: CBO1205: Transcriptional regulator, GntR family |
|
|
|
|
Gene: CTC01687: Transcriptional regulator, GntR family |
Transcriptional regulator, GntR family |
| CTC01686 |
|
|
|
|
|
|
|
Gene: CTC01686: hypothetical protein |
hypothetical protein |
| lp_2743 |
|
|
Gene: CBO1206: ABC-type multidrug transport system, ATPase component |
|
|
|
|
Gene: CTC01685: ABC-type multidrug transport system, ATPase component |
ABC-type multidrug transport system, ATPase component |
| CTC01684 |
|
|
|
|
|
|
|
Gene: CTC01684: hypothetical protein |
hypothetical protein |
| lp_2744 |
|
|
Gene: CBO1207: ABC-type multidrug transport system, permease component |
|
|
|
|
*
Clostridium tetani E88 Site: position = -94 score = 6.65061 sequence = TATAGTTAGTTATACATGTAACTAACCAAC Gene: CTC01397: ABC-type multidrug transport system, permease component |
ABC-type multidrug transport system, permease component |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |