Regulon of BC2903 in Paenibacillus sp. JDR-2

Properties
Regulator type:	Transcription factor
TF locus tag:	Pjdr2_5967
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Regulog:	BC2903 - Bacillales
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -58 Score: 6.7 Sequence: TATAGTTGATTACATGAGTAACCAACCACT Locus tag: Pjdr2_5967 Name: BC2903 Funciton: Transcriptional regulator, GntR family Locus tag: Pjdr2_5968 Name: lp_2743 Funciton: ABC-type multidrug transport system, ATPase component Locus tag: Pjdr2_5969 Name: lp_2744 Funciton: ABC-type multidrug transport system, permease component
	Pjdr2_5967	BC2903	Transcriptional regulator, GntR family
	Pjdr2_5968	lp_2743	ABC-type multidrug transport system, ATPase component
	Pjdr2_5969	lp_2744	ABC-type multidrug transport system, permease component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD