Regulog BC2903 - Bacillales
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Multidrug resistance; Multidrug efflux |
| Effector: | |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bacillales
- By TF family - GntR/Others
- By pathway - Multidrug resistance
- By pathway - Multidrug efflux
| Genome | Genes | Operons |
|---|---|---|
| Anoxybacillus flavithermus WK1 | ||
| Bacillus amyloliquefaciens FZB42 | ||
| Bacillus cereus ATCC 14579 | 4 | 2 |
| Bacillus clausii KSM-K16 | 6 | 2 |
| Bacillus halodurans C-125 | 3 | 1 |
| Bacillus licheniformis DSM 13 | ||
| Bacillus pumilus SAFR-032 | ||
| Bacillus subtilis subsp. subtilis str. 168 | ||
| Geobacillus kaustophilus HTA426 | ||
| Oceanobacillus iheyensis HTE831 | 6 | 2 |
| Paenibacillus sp. JDR-2 | 3 | 1 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| BC2903 |
|
|
*2
Bacillus cereus ATCC 14579 Site: position = -50 score = 7.01741 sequence = TATGGTTAATTACATAAGTAATGAACCTAT Gene: BC2904: Transcriptional regulator, GntR family Site: position = -228 score = 7.01741 sequence = TATGGTTAATTACATAAGTAATGAACCTAT Gene: BC2903: Transcriptional regulator, GntR family |
*2
Bacillus clausii KSM-K16 Site: position = -89 score = 6.12324 sequence = TATGGTTAACTACATAACCAGCTAACCAAA Gene: ABC0622: Transcriptional regulator, GntR family Site: position = -52 score = 6.22765 sequence = TATAGTTGATTACACTACTAATCAACCAAT Gene: ABC3409: Transcriptional regulator, GntR family |
*
Bacillus halodurans C-125 Site: position = -39 score = 7.21623 sequence = TATGGTTAGTTACATAAGTAATGAACCAAG Gene: BH3492: Transcriptional regulator, GntR family |
|
|
|
|
*2
Oceanobacillus iheyensis HTE831 Site: position = -62 score = 5.51674 sequence = TATAGTTATACACATGAGTATATAACCGTA Gene: OB0429: Transcriptional regulator, GntR family Site: position = -46 score = 7.31605 sequence = TATGGTTAGTTACATAAGTAATTAACCAAT Gene: OB0885: Transcriptional regulator, GntR family |
*
Paenibacillus sp. JDR-2 Site: position = -58 score = 6.65234 sequence = TATAGTTGATTACATGAGTAACCAACCACT Gene: Pjdr2_5967: Transcriptional regulator, GntR family |
Transcriptional regulator, GntR family |
| lp_2743 |
|
|
Gene: BC2902: ABC-type multidrug transport system, ATPase component |
2
Bacillus clausii KSM-K16 Gene: ABC0621: ABC-type multidrug transport system, ATPase component Gene: ABC3408: ABC-type multidrug transport system, ATPase component |
Gene: BH3493: ABC-type multidrug transport system, ATPase component |
|
|
|
|
2
Oceanobacillus iheyensis HTE831 Gene: OB0428: ABC-type multidrug transport system, ATPase component Gene: OB0886: ABC-type multidrug transport system, ATPase component |
Gene: Pjdr2_5968: ABC-type multidrug transport system, ATPase component |
ABC-type multidrug transport system, ATPase component |
| lp_2744 |
|
|
Gene: BC2901: ABC-type multidrug transport system, permease component |
2
Bacillus clausii KSM-K16 Gene: ABC0620: ABC-type multidrug transport system, permease component Gene: ABC3407: ABC-type multidrug transport system, permease component |
Gene: BH3494: ABC-type multidrug transport system, permease component |
|
|
|
|
2
Oceanobacillus iheyensis HTE831 Gene: OB0427: ABC-type multidrug transport system, permease component Gene: OB0887: ABC-type multidrug transport system, permease component |
Gene: Pjdr2_5969: ABC-type multidrug transport system, permease component |
ABC-type multidrug transport system, permease component |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |