Regulon of PCNPT3_10213 in Psychromonas sp. CNPT3

Properties
Regulator type:	Transcription factor
TF locus tag:	PCNPT3_10213
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Regulog:	PCNPT3_10213 - Psychromonadaceae/Aeromonadales
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 1 sites [see more]

Member of regulog collections

By taxonomy - Psychromonadaceae/Aeromonadales
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -39 Score: 6.5 Sequence: TAGTGTTATACATGAGTATAACACTA Locus tag: PCNPT3_10213 Name: PCNPT3_10213 Funciton: Transcriptional regulator, GntR family Locus tag: PCNPT3_10208 Name: XAC1547 Funciton: ABC transporter ATP-binding protein Locus tag: PCNPT3_10203 Name: XAC1546 Funciton: ABC transporter, permease protein
	PCNPT3_10213	PCNPT3_10213	Transcriptional regulator, GntR family
	PCNPT3_10208	XAC1547	ABC transporter ATP-binding protein
	PCNPT3_10203	XAC1546	ABC transporter, permease protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD