Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Regulog PCNPT3_10213 - Psychromonadaceae/Aeromonadales

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: Multidrug resistance; Multidrug efflux
Effector:
Phylum: Proteobacteria/Gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 1 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Psychromonas ingrahamii 37
Psychromonas sp. CNPT3 3 1
Moritella sp. PE36
Aeromonas hydrophila subsp. hydrophila ATCC 7966
Aeromonas salmonicida subsp. salmonicida A449
Tolumonas auensis DSM 9187
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
PCNPT3_10213
 
Psychromonas ingrahamii 37
*
Psychromonas sp. CNPT3

Site:
position = -39
score = 6.53578
sequence = TAGTGTTATACATGAGTATAACACTA

Gene: PCNPT3_10213: Transcriptional regulator, GntR family
 
Moritella sp. PE36
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
Transcriptional regulator, GntR family
XAC1547
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3

Gene: PCNPT3_10208: ABC transporter ATP-binding protein
 
Moritella sp. PE36
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
ABC transporter ATP-binding protein
XAC1546
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3

Gene: PCNPT3_10203: ABC transporter, permease protein
 
Moritella sp. PE36
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
ABC transporter, permease protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD