Regulog PCNPT3_10213 - Psychromonadaceae/Aeromonadales

Properties
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Phylum:	Proteobacteria/Gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 1 sites [see more]

Member of regulog collections

Statistics of regulated genes
Genome	Genes	Operons
Psychromonas ingrahamii 37
Psychromonas sp. CNPT3	3	1
Moritella sp. PE36
Aeromonas hydrophila subsp. hydrophila ATCC 7966
Aeromonas salmonicida subsp. salmonicida A449
Tolumonas auensis DSM 9187

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes							Function

CRON 1.
PCNPT3_10213	Psychromonas ingrahamii 37	* Psychromonas sp. CNPT3 Site: position = -39 score = 6.53578 sequence = TAGTGTTATACATGAGTATAACACTA Gene: PCNPT3_10213: Transcriptional regulator, GntR family	Moritella sp. PE36	Aeromonas hydrophila subsp. hydrophila ATCC 7966	Aeromonas salmonicida subsp. salmonicida A449	Tolumonas auensis DSM 9187	Transcriptional regulator, GntR family
XAC1547	Psychromonas ingrahamii 37	Psychromonas sp. CNPT3 Gene: PCNPT3_10208: ABC transporter ATP-binding protein	Moritella sp. PE36	Aeromonas hydrophila subsp. hydrophila ATCC 7966	Aeromonas salmonicida subsp. salmonicida A449	Tolumonas auensis DSM 9187	ABC transporter ATP-binding protein
XAC1546	Psychromonas ingrahamii 37	Psychromonas sp. CNPT3 Gene: PCNPT3_10203: ABC transporter, permease protein	Moritella sp. PE36	Aeromonas hydrophila subsp. hydrophila ATCC 7966	Aeromonas salmonicida subsp. salmonicida A449	Tolumonas auensis DSM 9187	ABC transporter, permease protein

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --