Regulog PCNPT3_10213 - Psychromonadaceae/Aeromonadales
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Multidrug resistance; Multidrug efflux |
| Effector: | |
| Phylum: | Proteobacteria/Gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Psychromonadaceae/Aeromonadales
- By TF family - GntR/Others
- By pathway - Multidrug resistance
- By pathway - Multidrug efflux
| Genome | Genes | Operons |
|---|---|---|
| Psychromonas ingrahamii 37 | ||
| Psychromonas sp. CNPT3 | 3 | 1 |
| Moritella sp. PE36 | ||
| Aeromonas hydrophila subsp. hydrophila ATCC 7966 | ||
| Aeromonas salmonicida subsp. salmonicida A449 | ||
| Tolumonas auensis DSM 9187 |
| Genes | Function | ||||||
|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||
| PCNPT3_10213 |
|
*
Psychromonas sp. CNPT3 Site: position = -39 score = 6.53578 sequence = TAGTGTTATACATGAGTATAACACTA Gene: PCNPT3_10213: Transcriptional regulator, GntR family |
|
|
|
|
Transcriptional regulator, GntR family |
| XAC1547 |
|
Gene: PCNPT3_10208: ABC transporter ATP-binding protein |
|
|
|
|
ABC transporter ATP-binding protein |
| XAC1546 |
|
Gene: PCNPT3_10203: ABC transporter, permease protein |
|
|
|
|
ABC transporter, permease protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |