Regulon of CPS_0449 in Pseudoalteromonas tunicata D2

Properties
Regulator type:	Transcription factor
TF locus tag:	PTD2_20187
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Regulog:	CPS_0449 - Alteromonadales
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Alteromonadales
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -61 Score: 4.8 Sequence: TGGTGTGCTGGTGATGTATAACACAT Locus tag: PTD2_20187 Name: CPS_0449 Funciton: Transcriptional regulator, GntR family Locus tag: PTD2_20182 Name: XAC1547 Funciton: ABC transporter ATP-binding protein Locus tag: PTD2_20177 Name: XAC1546 Funciton: ABC transporter, permease protein
	PTD2_20187	CPS_0449	Transcriptional regulator, GntR family
	PTD2_20182	XAC1547	ABC transporter ATP-binding protein
	PTD2_20177	XAC1546	ABC transporter, permease protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD