Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Regulog CPS_0449 - Alteromonadales

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: Multidrug resistance; Multidrug efflux
Effector:
Phylum: Proteobacteria/Gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Pseudoalteromonas atlantica T6c
Alteromonas macleodii 'Deep ecotype'
Glaciecola sp. HTCC2999
Colwellia psychrerythraea 34H 3 1
Alteromonadales bacterium TW-7
Pseudoalteromonas haloplanktis TAC125
Pseudoalteromonas tunicata D2 3 1
Idiomarina loihiensis L2TR
Idiomarina baltica OS145
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
CPS_0449
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
*
Colwellia psychrerythraea 34H

Site:
position = -58
score = 6.01717
sequence = CGGTGTGCTAGTGATGTATAACACTA

Gene: CPS_0449: Transcriptional regulator, GntR family
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
*
Pseudoalteromonas tunicata D2

Site:
position = -61
score = 4.84128
sequence = TGGTGTGCTGGTGATGTATAACACAT

Gene: PTD2_20187: Transcriptional regulator, GntR family
 
Idiomarina loihiensis L2TR
 
Idiomarina baltica OS145
Transcriptional regulator, GntR family
XAC1547
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H

Gene: CPS_0450: ABC transporter ATP-binding protein
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2

Gene: PTD2_20182: ABC transporter ATP-binding protein
 
Idiomarina loihiensis L2TR
 
Idiomarina baltica OS145
ABC transporter ATP-binding protein
XAC1546
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H

Gene: CPS_0451: ABC transporter, permease protein
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2

Gene: PTD2_20177: ABC transporter, permease protein
 
Idiomarina loihiensis L2TR
 
Idiomarina baltica OS145
ABC transporter, permease protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD
© 2009-2020 RegPrecise