Regulog CPS_0449 - Alteromonadales
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Multidrug resistance; Multidrug efflux |
| Effector: | |
| Phylum: | Proteobacteria/Gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Alteromonadales
- By TF family - GntR/Others
- By pathway - Multidrug resistance
- By pathway - Multidrug efflux
| Genome | Genes | Operons |
|---|---|---|
| Pseudoalteromonas atlantica T6c | ||
| Alteromonas macleodii 'Deep ecotype' | ||
| Glaciecola sp. HTCC2999 | ||
| Colwellia psychrerythraea 34H | 3 | 1 |
| Alteromonadales bacterium TW-7 | ||
| Pseudoalteromonas haloplanktis TAC125 | ||
| Pseudoalteromonas tunicata D2 | 3 | 1 |
| Idiomarina loihiensis L2TR | ||
| Idiomarina baltica OS145 |
| Genes | Function | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||
| CPS_0449 |
|
|
|
*
Colwellia psychrerythraea 34H Site: position = -58 score = 6.01717 sequence = CGGTGTGCTAGTGATGTATAACACTA Gene: CPS_0449: Transcriptional regulator, GntR family |
|
|
*
Pseudoalteromonas tunicata D2 Site: position = -61 score = 4.84128 sequence = TGGTGTGCTGGTGATGTATAACACAT Gene: PTD2_20187: Transcriptional regulator, GntR family |
|
|
Transcriptional regulator, GntR family |
| XAC1547 |
|
|
|
Gene: CPS_0450: ABC transporter ATP-binding protein |
|
|
Gene: PTD2_20182: ABC transporter ATP-binding protein |
|
|
ABC transporter ATP-binding protein |
| XAC1546 |
|
|
|
Gene: CPS_0451: ABC transporter, permease protein |
|
|
Gene: PTD2_20177: ABC transporter, permease protein |
|
|
ABC transporter, permease protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |