Regulon of YhcF in Clostridium nexile DSM 1787

Properties
Regulator type:	Transcription factor
TF locus tag:	CLONEX_00374
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Regulog:	YhcF - Clostridia-3
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-3
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -44 Score: 6.1 Sequence: ATTGTATTAACTCAATAATACATT Locus tag: CLONEX_00079 Name: BLAHAN_01094 Funciton: ABC-type multidrug transport system, ATPase component Locus tag: CLONEX_00080 Name: BLAHAN_01093 Funciton: ABC-type multidrug transport system, permease component
	CLONEX_00079	BLAHAN_01094	ABC-type multidrug transport system, ATPase component
	CLONEX_00080	BLAHAN_01093	ABC-type multidrug transport system, permease component
Position: -40 Score: 6.5 Sequence: ATTGTATTATATATTTAATACAAA Locus tag: CLONEX_00374 Name: yhcF Funciton: Transcriptional regulator, GntR family Locus tag: CLONEX_00375 Name: yhcG Funciton: ABC-type multidrug transport system, ATPase component Locus tag: CLONEX_00376 Name: yhcI Funciton: ABC-type multidrug transport system, permease component
	CLONEX_00374	yhcF	Transcriptional regulator, GntR family
	CLONEX_00375	yhcG	ABC-type multidrug transport system, ATPase component
	CLONEX_00376	yhcI	ABC-type multidrug transport system, permease component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD