Regulog YhcF - Clostridia-3
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Multidrug resistance; Multidrug efflux |
| Effector: | |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Clostridia-3
- By TF family - GntR/Others
- By pathway - Multidrug resistance
- By pathway - Multidrug efflux
| Genome | Genes | Operons |
|---|---|---|
| Bacteroides pectinophilus ATCC 43243 | ||
| Blautia hansenii DSM 20583 | 3 | 1 |
| Bryantella formatexigens DSM 14469 | ||
| Clostridiales bacterium 1_7_47_FAA | ||
| Clostridium bolteae ATCC BAA-613 | ||
| Clostridium nexile DSM 1787 | 5 | 2 |
| Clostridium scindens ATCC 35704 | 5 | 2 |
| Dorea formicigenerans ATCC 27755 | 3 | 1 |
| Dorea longicatena DSM 13814 | ||
| Eubacterium eligens ATCC 27750 | ||
| Eubacterium rectale ATCC 33656 | ||
| Roseburia intestinalis L1-82 | ||
| Ruminococcus gnavus ATCC 29149 | 3 | 1 |
| Ruminococcus lactaris ATCC 29176 |
| Genes | Function | ||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||||
| yhcF |
|
*
Blautia hansenii DSM 20583 Site: position = -59 score = 6.28142 sequence = ATTGTACTAATCAAATAATACAGT Gene: BLAHAN_00454: Transcriptional regulator, GntR family |
|
|
|
*
Clostridium nexile DSM 1787 Site: position = -40 score = 6.48162 sequence = ATTGTATTATATATTTAATACAAA Gene: CLONEX_00374: Transcriptional regulator, GntR family |
*
Clostridium scindens ATCC 35704 Site: position = -49 score = 6.12637 sequence = ATTGTACTATATAGATAATACAAC Gene: CLOSCI_00067: Transcriptional regulator, GntR family |
*
Dorea formicigenerans ATCC 27755 Site: position = -50 score = 5.10931 sequence = ATTGTATTGCTCAGATAGTACAAT Gene: DORFOR_00789: Transcriptional regulator, GntR family |
|
|
|
|
*
Ruminococcus gnavus ATCC 29149 Site: position = -53 score = 5.98397 sequence = ATTGTATTACATATATAGTACAGT Gene: RUMGNA_02108: Transcriptional regulator, GntR family |
|
Transcriptional regulator, GntR family |
| yhcG |
|
Gene: BLAHAN_00455: ABC-type multidrug transport system, ATPase component |
|
|
|
Gene: CLONEX_00375: ABC-type multidrug transport system, ATPase component |
Gene: CLOSCI_00066: ABC-type multidrug transport system, ATPase component |
Gene: DORFOR_00790: ABC-type multidrug transport system, ATPase component |
|
|
|
|
Gene: RUMGNA_02107: ABC-type multidrug transport system, ATPase component |
|
ABC-type multidrug transport system, ATPase component |
| yhcI |
|
Gene: BLAHAN_00456: ABC-type multidrug transport system, permease component |
|
|
|
Gene: CLONEX_00376: ABC-type multidrug transport system, permease component |
Gene: CLOSCI_00065: ABC-type multidrug transport system, permease component |
Gene: DORFOR_00791: ABC-type multidrug transport system, permease component |
|
|
|
|
Gene: RUMGNA_02106: ABC-type multidrug transport system, permease component |
|
ABC-type multidrug transport system, permease component |
| CRON 2. | |||||||||||||||
| BLAHAN_01094 |
|
Gene: BLAHAN_01094: ABC-type multidrug transport system, ATPase component |
|
|
|
*
Clostridium nexile DSM 1787 Site: position = -44 score = 6.05726 sequence = ATTGTATTAACTCAATAATACATT Gene: CLONEX_00079: ABC-type multidrug transport system, ATPase component |
*
Clostridium scindens ATCC 35704 Site: position = -53 score = 6.28565 sequence = ATTGTACTAAGTTTATAATACAGT Gene: CLOSCI_01184: ABC-type multidrug transport system, ATPase component |
Gene: DORFOR_01918: ABC-type multidrug transport system, ATPase component |
|
Gene: EUBELI_20033: ABC-type multidrug transport system, ATPase component |
Gene: EUBREC_0968: ABC-type multidrug transport system, ATPase component |
|
Gene: RUMGNA_01315: ABC-type multidrug transport system, ATPase component |
|
ABC-type multidrug transport system, ATPase component |
| BLAHAN_01093 |
|
Gene: BLAHAN_01093: ABC-type multidrug transport system, permease component |
|
|
|
Gene: CLONEX_00080: ABC-type multidrug transport system, permease component |
Gene: CLOSCI_01183: ABC-type multidrug transport system, permease component |
Gene: DORFOR_01919: ABC-type multidrug transport system, permease component |
|
Gene: EUBELI_20032: ABC-type multidrug transport system, permease component |
Gene: EUBREC_0969: ABC-type multidrug transport system, permease component |
|
Gene: RUMGNA_01316: ABC-type multidrug transport system, permease component |
|
ABC-type multidrug transport system, permease component |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |