Regulon of YtrA in Blautia hansenii DSM 20583

Properties
Regulator type:	Transcription factor
TF locus tag:	BLAHAN_02527
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux; Antibiotic resistance
Effector:
Regulog:	YtrA - Clostridia-3
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-3
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux
By pathway - Antibiotic resistance

Regulated operons
	Locus Tag	Name	Function
Position: -35 Score: 6.4 Sequence: AAGTGTACTAGGATACATAGTACACAC Locus tag: BLAHAN_02527 Name: ytrA Funciton: Transcriptional regulator, GntR family Locus tag: BLAHAN_02526 Name: ytrB Funciton: ABC-type multidrug transport system, ATPase component Locus tag: BLAHAN_02525 Name: ytrD Funciton: ABC-type transport system, permease component
	BLAHAN_02527	ytrA	Transcriptional regulator, GntR family
	BLAHAN_02526	ytrB	ABC-type multidrug transport system, ATPase component
	BLAHAN_02525	ytrD	ABC-type transport system, permease component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD