Regulog YtrA - Clostridia-3

Member of regulog collections
- By taxonomy - Clostridia-3
- By TF family - GntR/Others
- By pathway - Multidrug resistance
- By pathway - Multidrug efflux
- By pathway - Antibiotic resistance
Genome | Genes | Operons |
---|---|---|
Bacteroides pectinophilus ATCC 43243 | 1 | 1 |
Blautia hansenii DSM 20583 | 3 | 1 |
Bryantella formatexigens DSM 14469 | 3 | 1 |
Clostridiales bacterium 1_7_47_FAA | 3 | 1 |
Clostridium bolteae ATCC BAA-613 | 3 | 1 |
Clostridium nexile DSM 1787 | ||
Clostridium scindens ATCC 35704 | ||
Dorea formicigenerans ATCC 27755 | ||
Dorea longicatena DSM 13814 | ||
Eubacterium eligens ATCC 27750 | 3 | 1 |
Eubacterium rectale ATCC 33656 | 3 | 1 |
Roseburia intestinalis L1-82 | 3 | 1 |
Ruminococcus gnavus ATCC 29149 | ||
Ruminococcus lactaris ATCC 29176 |
Genes | Function | ||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
CRON 1. | |||||||||||||||
ytrA |
*
Bacteroides pectinophilus ATCC 43243 Site: position = -50 score = 6.44856 sequence = AACTGTATTAATCGTACTAATACAGTT Gene: BACPEC_03005: Transcriptional regulator, GntR family |
*
Blautia hansenii DSM 20583 Site: position = -35 score = 6.41614 sequence = AAGTGTACTAGGATACATAGTACACAC Gene: BLAHAN_02527: Transcriptional regulator, GntR family |
*
Bryantella formatexigens DSM 14469 Site: position = -51 score = 6.26909 sequence = AGGTGTACTAACATGAATAATACACTT Gene: BRYFOR_04902: Transcriptional regulator, GntR family |
*
Clostridiales bacterium 1_7_47_FAA Site: position = -62 score = 6.68683 sequence = AACTGTACTAATATAATTAATACAGTC Gene: Cbac1_010100025257: Transcriptional regulator, GntR family |
*
Clostridium bolteae ATCC BAA-613 Site: position = -65 score = 6.22047 sequence = AACTGTATTAATATACTTAATACAGAT Gene: CLOBOL_00493: Transcriptional regulator, GntR family |
|
|
|
|
*
Eubacterium eligens ATCC 27750 Site: position = -77 score = 6.99764 sequence = AACTGTACTAATTAACATAGTACAGTT Gene: EUBELI_00141: Transcriptional regulator, GntR family |
*
Eubacterium rectale ATCC 33656 Site: position = -119 score = 5.19011 sequence = AGGTGTATCACGTTGGATAGTACACTG Gene: EUBREC_2290: Transcriptional regulator, GntR family |
*
Roseburia intestinalis L1-82 Site: position = -49 score = 4.89229 sequence = GACCGTATGATAGAAAATAGTACGGTT Gene: ROSINTL182_02006: Transcriptional regulator, GntR family |
|
|
Transcriptional regulator, GntR family |
ytrB |
Gene: BACPEC_03004: ABC-type multidrug transport system, ATPase component |
Gene: BLAHAN_02526: ABC-type multidrug transport system, ATPase component |
Gene: BRYFOR_04903: ABC-type multidrug transport system, ATPase component |
Gene: Cbac1_010100025262: ABC-type multidrug transport system, ATPase component |
Gene: CLOBOL_00492: ABC-type multidrug transport system, ATPase component |
Gene: CLONEX_03949: ABC-type multidrug transport system, ATPase component |
|
|
|
Gene: EUBELI_00142: ABC-type multidrug transport system, ATPase component |
Gene: EUBREC_2289: ABC-type multidrug transport system, ATPase component |
Gene: ROSINTL182_02007: ABC-type multidrug transport system, ATPase component |
|
|
ABC-type multidrug transport system, ATPase component |
ytrD |
Gene: BACPEC_03003: ABC-type transport system, permease component |
Gene: BLAHAN_02525: ABC-type transport system, permease component |
Gene: BRYFOR_04904: ABC-type transport system, permease component |
Gene: Cbac1_010100025267: ABC-type transport system, permease component |
Gene: CLOBOL_00491: ABC-type transport system, permease component |
Gene: CLONEX_03950: ABC-type transport system, permease component |
|
|
|
Gene: EUBELI_00143: ABC-type transport system, permease component |
Gene: EUBREC_2288: ABC-type transport system, permease component |
Gene: ROSINTL182_02008: ABC-type transport system, permease component |
|
|
ABC-type transport system, permease component |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |