Regulon of YtrA in Clostridium novyi NT

Properties
Regulator type:	Transcription factor
TF locus tag:	NT01CX_0244
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux; Antibiotic resistance
Effector:
Regulog:	YtrA - Clostridia-1
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-1
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux
By pathway - Antibiotic resistance

Regulated operons
	Locus Tag	Name	Function
Position: -121 Score: 7.4 Sequence: AAGTGTACTAGTTAAATTAATACACTT Locus tag: NT01CX_0244 Name: ytrA Funciton: Transcriptional regulator, GntR family Locus tag: NT01CX_0243 Name: ytrB Funciton: ABC-type transport system, ATPase component Locus tag: NT01CX_0242 Name: ytrC Funciton: ABC-type transport system, permease component Locus tag: NT01CX_0241 Name: null Funciton: ABC transporter, ATP-binding protein Locus tag: NT01CX_0240 Name: null Funciton: Related to ABC transporter permease component
	NT01CX_0244	ytrA	Transcriptional regulator, GntR family
	NT01CX_0243	ytrB	ABC-type transport system, ATPase component
	NT01CX_0242	ytrC	ABC-type transport system, permease component
	NT01CX_0241		ABC transporter, ATP-binding protein
	NT01CX_0240		Related to ABC transporter permease component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD